Ιούλιος 2022 αρχείο

Δεν Κατεβαζουμε Καμια Εφαρμογη Ψηφιακης Ταυτοτητας Και Διπλωματος Ή Καθε Είδους! . Δεν Δεχόμαστε Να Γίνουμε Barcode & QR!

Δεν υπάρχει μεγαλύτερη ανοησία από το να δεχτεί κάποιος την ταυτότητα στο κινητό του.    Freek Jansen Ολλανδός πολιτικός_«Φανταστείτε ότι, με το πάτημα ενός κουμπιού, μπορούν να σας στερήσουν την πρόσβαση στα κοινωνικά μέσα επειδή διασπείρετε ”ψευδείς ειδήσεις”. Η άδεια οδήγησής σας ακυρωμένη επειδή οδηγείτε ένα μη-φιλικό προς το περιβάλλον αυτοκίνητο. Το αεροπορικό σας εισιτήριο …

Συνέχεια ανάγνωσης

Δικαίωση γιατρίνας από το Διοικητικό Εφετείο Πατρών αποτελεί δεδικασμένο προς όφελος των συναδέλφων που βρίσκονται υπό αναστολή λόγω άρνησης να εμβολιαστούν

Απόφαση – σταθμός για ανεμβολίαστους υγειονομικούς: Το Δικαστήριο της Πάτρας «δικαίωσε» γιατρό νοσοκομείου σε αναστολή εργασίας Η απόφαση είναι η πρώτη του είδους πανελλαδικά και σίγουρα θα αποτελέσει όπλο στη φαρέτρα των ανεμβολίαστων υγειονομικών 26 Ιούλ. 2022 Σωτήρης Παπανδρέου Τη νομοθεσία που προβλέπει διοικητικές κυρώσεις στους ανεμβολίαστους υγειονομικούς λόγω κορονοϊού και τις σχετικές αποφάσεις των …

Συνέχεια ανάγνωσης

Ο COVID-19γερνάει τον εγκέφαλο και τα εμβόλια εναντίον του ακόμη περισσότερο!

Ο COVID-19 μπορεί να κάνει τον εγκέφαλο να γεράσει κατά 2 δεκαετίες. Εδώ είναι 1 τρόπος για να αντιστρέψετε τη γήρανση ΑΠΟ ΤΟΝ Δρ. Yuhong Dong and Health 1+1 ΩΡΑ 22 Ιουλίου 2022 Μια νέα βρετανική μελέτη διαπίστωσε ότι ο αρχικός ιός SARS-CoV-2 (δηλαδή το στέλεχος Wuhan) μπορεί να βλάψει τη γνωστική ικανότητα με τρόπο …

Συνέχεια ανάγνωσης

Μεταλλαγμένος SARS coronavirus Urbani κλώνος SARS-Urbani-MA_SHCO14-spike, το πλήρες γονιδίωμα

NOTICE Μεταλλαγμένος SARS coronavirus Urbani κλώνοςSARS-Urbani-MA_SHCO14-spike, το πλήρες γονιδίωμα Since 2004, there have not been any known cases of SARS reported anywhere in the world. The content in this PDF was developed for the 2003 SARS epidemic. But, some guidelines are still being used. Any new SARS updates will be posted on this Web site. …

Συνέχεια ανάγνωσης

Για όσους αμφισβητούν την ύπαρξη του κορωνοϊού της Wuhan. Ολόκληρο το γονιδίωμα

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (Σοβαρό Οξύ Αναπνευστικό Σύνδρομο οφειλόμενο στον απομονωμένο κορωνοϊό 2 της Wuhan-Hu-1 πιο κάτω το πλήρες γονιδίωμα). GenBank: MN908947.3 GenBank Graphics >MN908947.3 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG TTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTC CCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC GTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGG CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT TCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTA GGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTG TTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTG TCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTG …

Συνέχεια ανάγνωσης

Νέα μελέτη διαπιστώνει ότι η φυσική ανοσία στον Covid-19 δεν μειώνεται ούτε κατά 1%, αλλά οι εμβολιασμένοι αναπτύσσουν σύνδρομο επίκτητης ανοσοανεπάρκειας

Μια νέα επιστημονική μελέτη διαπίστωσε ότι η φυσική ανοσία στον Covid-19 δεν μειώνεται ούτε κατά 1%, αλλά τα δεδομένα του πραγματικού κόσμου δυστυχώς δείχνουν ότι δεν μπορεί να ειπωθεί το ίδιο για την ανοσία που αποκτήθηκε με εμβόλιο. Αντίθετα, τα δεδομένα δείχνουν τεράστια υποβάθμιση του ανοσοποιητικού συστήματος μεταξύ του εμβολιασμένου πληθυσμού, που μπορεί να περιγραφεί …

Συνέχεια ανάγνωσης

ΤΡΟΠΟΙ ΑΦΑΙΡΕΣΗΣ ΤΟΥ ΟΞΕΙΔΙΟΥ ΤΟΥ ΓΡΑΦΕΝΙΟΥ ΑΠΟ ΤΟ ΣΩΜΑ ΜΑΣ

Το οξείδιο του γραφενίου, μια ουσία που είναι δηλητηριώδης για τον άνθρωπο, έχει βρεθεί στα «εμβόλια» κατά του Covid 19, στην παροχή νερού, στον αέρα που αναπνέουμε μέσω των χημικών ιχνών προϊόντων ψεκασμού από τα ειδικά διαμορφωμένα αγνώστου ταυτότητας αεροπλάνα, ακόμη και στα τρόφιμα μας. Το οξείδιο του γραφενίου αλληλεπιδρά και ενεργοποιείται από τις ηλεκτρομαγνητικές …

Συνέχεια ανάγνωσης

Ελάτε τώρα ο Παναγιώτατος και ο Μακαριώτατος είναι οικουμενιστές. Εξουσιαστές συστημικοί, δούλοι της παγκόσμιας χούντας είναι!

Παναγιώτης Σημάτης : Οὔτε τὴν σκόνη τῶν Οἰκουμενιστῶν! ΑΡΘΡΟΓΡΑΦΟΙ. ΠΑΝΑΓΙΩΤΗΣ ΣΗΜΑΤΗΣ. – 25 Ιούλ 2022 – 12:55 Το διάβασαν: 657 Ὁ π. Ἀθανάσιος Μυτιληναῖος σὲ ὁμιλία του στὶς “Πράξεις τῶν Ἀποστόλων”, μᾶς ἐξηγεῖ τὴν Ἐντολὴ τοῦ Χριστοῦ, σύμφωνα μὲ τὴν ὁποία, πρέπει νὰ δείχνουμε ἔμπρακτα καὶ συμβολικά, ὅτι δὲν ἔχουμε καμιὰ σχέση μὲ τοὺς ἀσεβεῖς. …

Συνέχεια ανάγνωσης

Τελικά ανθρώπινα ζόμπι θα μάθετε να μην σκουντουφλάτε στις λεωφόρους σας πάνω σε πίθηκους ή μήπως βρισκόσαστε στον πλανήτη των πιθήκων;

Μάλλον το πρώτο υποθέτω…. ΕΙΝΑΙ ΠΑΣΙΓΝΩΣΤΟ ΟΤΙ Η ΕΥΡΩΠΗ ΕΙΝΑΙ ΓΕΜΑΤΗ ΠΙΘΗΚΟΥΣ, ΠΟΥ ΚΥΚΛΟΦΟΡΟΥΝ ΑΡΡΩΣΤΟΙ ΣΤΟ ΔΡΟΜΟ ΚΑΙ ΜΟΛΥΝΟΥΝ. Η ΕΠΙΘΕΣΗ ΚΑΤΑ ΤΟΥ… ΥΓΕΙΑ. – 25 Ιούλ 2022 – 10:28   ….ΑΝΘΡΩΠΙΝΟΥ ΕΙΔΟΥΣ ΣΥΝΕΧΙΖΕΤΑΙ, ΑΠΟ ΤΗΝ BIG PHARMA ΠΕΡΝΩΝΤΑΣ ΣΕ ΑΛΛΟ ΕΠΙΠΕΔΟ… Κωνσταντίνος Αρβανίτης  Είτε είναι ιός των μαϊμούδων, είτε είναι μαϊμού ιός, αυτό που …

Συνέχεια ανάγνωσης

Όπως έλεγε ο Μοντανιέ οι επαναλαμβανόμενες δόσεις (Boosters) θα δημιουργήσουν το σενάριο HIV/AIDS!!!

Ο Μπιλ Γκέιτς λέει ότι μια άλλη πανδημία έρχεται σύντομα!! Πιθανότατα γνωρίζει ότι το mRNA Vaxx and οι επαναλαμβανόμενες δόσεις (Boosters) θα δημιουργήσουν το σενάριο HIV/AIDS!! Covid-19 mRNA Jab Δεν έχει σχεδιαστεί για την εξάλειψη του ιού, αλλά για τη δημιουργία παραλλαγών, επαναλαμβανόμενων ενισχυτών εξάτμισης και αποδυνάμωσης του ανοσοποιητικού συστήματος… Και πολλά άλλα φρίκη!! 22 …

Συνέχεια ανάγνωσης