Το ισχαιμικό προφανώς δεν οφείλεται στο μπόλι γιατί αυτός έκανε το CINOVAC από αδρανοποιημένο ιό

Αν και το CINOVAC προέρχεται από αδρανή ιό καλλιεργημένο στα νεφρικά κύτταρα εκτρωμένου-ζωντανού εμβρύου. (Κατά τον ιερέα-Ψυχίατρο Στυλιανό Καρπαθίου).

Τοποθετήθηκε στεντ στον Πατριάρχη Βαρθολομαίο μέσω στεφανιογραφίας έπειτα από ισχαιμικό επεισόδιο

Ο 81 ετών Βαρθολομαίος είχε εισαχθεί την Τρίτη στο νοσοκομείο για εξετάσεις και κρίθηκε αναγκαίο να υποβληθεί στην επέμβαση

Επιβεβαιώθηκε η είδηση που είχε αποκαλύψει πρώτο το ΚΟΥΡΔΙΣΤΟ ότι ο Οικουμενικός Πατριάρχης Βαρθολομαίος υπέστη ισχαιμικό επεισόδιο κατά τη διάρκεια του ταξιδιού του στις ΗΠΑ στις 25 Νοεμβρίου, όπου και νοσηλεύτηκε στο νοσοκομείο George Washington. Έπειτα από εξετάσεις που του έγιναν και μετά τη σταθεροποίηση της υγείας του κρίθηκε ασφαλές να πραγματοποιήσει έναν πρώτο κύκλο συναντήσεων, μεταξύ των οποίων και η πολύ σημαντική συνάντηση του με τον Joe Biden στον Λευκό Οίκο.

Λίγο πριν ξεκινήσει το ταξίδι της επιστροφής, οι γιατροί τον συμβούλεψαν να υποβληθεί σε μια επέμβαση αγγειπλαστικής, κάτι που πράγματι συνέβη εχθές το βράδυ (τοπική ώρα) στο νοσοκομείο Mount Sinai στο Μανχάταν της Νέας Υόρκης. Σύμφωνα με ανακοίνωση της Ιεράς Αρχιεπισκοπής Αμερικής, ο κ. Βαρθολομαίος είχε εισαχθεί την Τρίτη στο νοσοκομείο για εξετάσεις και κρίθηκε αναγκαίο να υποβληθεί στην επέμβαση και στην τοποθέτηση στεντ μέσω στεφανιογραφίας. Ο Πατριάρχης αναμένεται να πάρει εξιτήριο σήμερα το απόγευμα (ώρα Ελλάδας).

Ο 81ετής πατριάρχης Κωνσταντινουπόλεως βρίσκεται εδώ και ημέρες στις ΗΠΑ με αφορμή τα θυρανοίξια του ιερού ναού του Αγίου Νικολάου στο «Σημείο Μηδέν» στο Μανχάταν. Η τελετή έγινε την περασμένη Τρίτη σε κλίμα βαθιάς συγκίνησης καθώς ο ναός είχε θαφτεί ολοκληρωτικά μετά την κατάρρευση του νότιου ουρανοξύστη από τους Δίδυμους Πύργους στις τρομοκρατικές επιθέσεις της 11ης Σεπτεμβρίου 2001.

Η Διαδερμική διαυλική αγγειοπλαστική με μπαλόνι [Percutaneous Transluminal Balloon Angioplasty] – όπως ονομάζεται ακριβέστερα – είναι η διαπλάτυνση ενός στενωμένου αγγείου με ειδικό καθετήρα που στην άκρη του έχει ένα μικρό μπαλόνι και που εισάγεται μέσα στον αυλό του αγγείου διαμέσου του δέρματος χωρίς να γίνει χειρουργική τομή. Η επέμβαση γίνεται συνήθως με τοπική αναισθησία. Αρχικά παρακεντάται μια αρτηρία με εύκολη πρόσβαση, όπως η μηριαία αρτηρία στη βουβωνική περιοχή, η βραχιόνια αρτηρία στο βραχίονα ή η κερκιδική στον καρπό. Προωθείται ένας καθετήρας προς την περιοχή του ενδιαφέροντος, γίνεται έγχυση σκιαγραφικής ουσίας και λαμβάνονται ακτινογραφίες (αγγειογραφία).

Κατόπιν γίνεται η αγγειοπλαστική με μπαλόνι, δηλαδή ο ιατρός φουσκώνει με αέρα το μπαλόνι μέσα στο στενωμένο αγγείο. Αυτό βοηθά να διευρυνθεί το αγγείο και να αυξηθεί η ροή του αίματος που περνάει μέσα απ’ αυτό.

Σε ορισμένες περιπτώσεις μπορεί να γίνει τοποθέτηση ενός μεταλλικού stent (ενδονάρθηκα) μέσα στο αγγείο για υποστήριξη του τοιχώματός του ώστε να το διατηρήσει ανοικτό. Το stent είναι σωληνάκι με τοίχωμα σε μορφή μεταλλικού πλέγματος, συνήθως κατασκευασμένο από nitinol. Η απόφαση για χρήση stent ή όχι εξαρτάται κυρίως από τη θέση και τη φύση της βλάβης.

ΠΗΓΗ:https://kourdistoportocali.com/news-desk/pliris-epivevaiosi-toy-koyrdistoy-gt-topothetithike-stent-ston-patriarchi-vartholomaio-meso-stefaniografias/

Περίεργες αναφορές για ασθένειες που εκδηλώνονται με κοιλιακό άλγος, αναπνευστικά προβλήματα, θρομβώσεις, καρδιακές παθήσεις ακόμη και απόπειρες αυτοκτονίας, μεταξύ άλλων καταστάσεων.

Iσραηλινοί επιστήμονες άνοιξαν το Μαύρο Κουτί της COVID-19. Δείτε τα εκπληκτικά ευρήματα ενώ στις ΗΠΑ ξαφνικά οι εντατικές γεμίζουν με ραγισμένες καρδιές νέων

-Αυτή η αναφορά στις «καρδιακές παθήσεις» τράβηξε αμέσως την προσοχή μου, γιατί το βλέπω τόσο πολύ στις ειδήσεις τελευταία

Πρωτεΐνες COVID που προκαλούν εγκεφαλικά και καρδιακά επεισόδια που εντοπίστηκαν από την Ισραηλινή ομάδα
Η ανακάλυψη έγινε μετά που έρευνα η οποία επικεντρώθηκε στο μαύρο κουτί του ιού

«Ελάτε να ανοίξουμε το Μαύρο Κουτί του Ιού»

Με αυτό το στόχο οι ερευνητές-επιστήμονες του Πανεπιστημίου του Τel Aviv ρίχθηκαν με τα μούτρα την έρευνα και κατάφεραν να αναλύσουν και τις 29 πρωτεΐνες του ιού ώστε να καταλάβουν ποιες από αυτές καταστρέφουν το αγγειακό σύστημα. Η ερευνά τους θα μπορούσε να οδηγήσει σε θεραπείες που θα σταματήσουν τον όλεθρο στο αγγειακό σύστημα.
-Κάναμε την ανακάλυψη ρίχνοντας μια ματιά στο μαύρο κουτί του ιού, δηλώνει ο Δρ. Ben Maoz-κεντρική photo, από το Πανεπιστήμιο Τel Aviv στον ιατρικό συντάκτη Nathan Jeffay των Times of Israel.

«Ο κορωνοϊός δεν είναι η καθαρά αναπνευστική νόσος που σκεφτήκαμε αρχικά και έχουμε εντοπίσει τις πρωτεΐνες που θέτουν τους ασθενείς σε αυξημένο κίνδυνο εγκεφαλικού επεισοδίου, καρδιακής προσβολής και άλλων προβλημάτων που σχετίζονται με το αγγειακό σύστημα», εξηγεί ο Maoz.

Από τις 29 πρωτεΐνες του SARS-CoV-2 οι πέντε οδηγούν σε αγγειακά προβλήματα σύμφωνα με την έρευνα που δημοσίευσε το επιστημονικό περιοδικό eLife.

«Αυτή η εργασία θα μπορούσε κάλλιστα να βοηθήσει τους επιστήμονες να αναπτύξουν φάρμακα για την αντιμετώπιση της επίδρασης του κορωνοϊού στο αγγειακό σύστημα, παρέχοντας μια κατανόηση του ποιες ακριβώς πρωτεΐνες ή κομμάτια του ιού προκαλούν προβλήματα», εξηγεί ο Maoz.

Το εργαστήριό του, το οποίο επικεντρώνεται στη βιοϊατρική μηχανική και τη νευροεπιστήμη, συνεργάστηκε με άλλα τμήματα του Πανεπιστημίου του Tel Aviv για να δημιουργήσει μια προσομοίωση ενός ανθρώπινου αγγειακού συστήματος και να παρατηρήσει την επίδραση και των 29 πρωτεϊνών του κορωνοϊού. Από την ανάλυσή τους, μπόρεσαν να προσδιορίσουν ποιες από αυτές επηρέασαν το αγγειακό σύστημα — και πώς.

«Δεν ανακαλύψαμε μόνο ποιες πρωτεΐνες έχουν αντίκτυπο στο αγγειακό σύστημα, αλλά είδαμε επίσης πώς ακριβώς ασκούν την επίδρασή τους», είπε ο Maoz. «Αυτό που βρήκαμε είναι ότι αυτές οι συγκεκριμένες πρωτεΐνες κάνουν τα αγγεία πιο πορώδη με αποτέλεσμα να μην μπορούν να συγκρατήσουν υγρό (σ.γ.:προφανώς τον ορό του αίματος) όπως θα ήλπιζαν. Αυτές οι πληροφορίες είναι επίσης πολύτιμες στις προσπάθειες για την ανάπτυξη φαρμάκων».

Ο Maoz ελπίζει να θέσει τα θεμέλια για πιο λεπτή θεραπεία του κορωνοϊού.
«Μέχρι σήμερα ο ιός αντιμετωπίζεται ως μία οντότητα, παρά το γεγονός ότι επηρεάζει διαφορετικά μέρη του σώματος με διαφορετικούς τρόπους».

«Όλα τα στοιχεία δείχνουν ότι ο ιός βλάπτει σοβαρά τα αιμοφόρα αγγεία ή τα ενδοθηλιακά κύτταρα που επενδύουν τα αιμοφόρα αγγεία. Ελπίζω ότι η έρευνά μας θα αποδειχθεί χρήσιμη και να επιτρέψει μια πιο στοχευμένη θεραπεία.»

Την ίδια στιγμή στις ΗΠΑ αίφνης οι εντατικές ασφυκτιούν και δεν είναι από Covid-19.
Σε μια χρονιά που έχει ήδη γεμίσει με τόσα πολλά μυστήρια, έχω ένα άλλο πολύ περίεργο να μοιραστώ μαζί σας. Τα δωμάτια έκτακτης ανάγκης (εντατικές) είναι γεμάτα σε όλη την Αμερική και κανείς δεν φαίνεται να μπορεί να εξηγήσει γιατί συμβαίνει αυτό.-

by Tyler Durden-ZeroHedge
Wednesday, Nov 03, 2021 – 05:00 PM

Αυτήν τη στιγμή, ο αριθμός των νέων περιπτώσεων COVID στις Ηνωμένες Πολιτείες κάθε μέρα είναι λιγότερος από το μισό από αυτό που ήταν μόλις πριν από μερικούς μήνες. Αυτά είναι πραγματικά καλά νέα και πολλοί πιστεύουν ότι αυτό είναι ένα σημάδι ότι η πανδημία εξασθενεί. Ας ελπίσουμε ότι αυτό είναι αλήθεια.

Με λιγότερους ανθρώπους να κολλάνε τον ιό, θα νομίζατε ότι αυτό θα σήμαινε ότι τα δωμάτια έκτακτης ανάγκης θα πρέπει να αδειάζουν, αλλά στην πραγματικότητα συμβαίνει το αντίθετο. Σε όλη τη χώρα, οι αίθουσες επειγόντων περιστατικών είναι απολύτως γεμάτες και σε πολλές περιπτώσεις βλέπουμε βαριά άρρωστους ασθενείς να φροντίζονται στους διαδρόμους, επειδή όλες οι αίθουσες ER είναι ήδη γεμάτες. Σ.γ.: Από ανεμβολίαστους ή εμβολιασμένους; το δημοσίευμα δεν μας λέει.

Επιτρέψτε μου να σας δώσω ένα παράδειγμα για αυτό για το οποίο μιλάω. Τα παρακάτω προέρχονται από ένα άρθρο με τίτλο «Οι ERs είναι γεμάτοι με σοβαρά άρρωστους ασθενείς, αν και πολλοί δεν έχουν Covid- “ERs Are Swamped With Seriously Ill Patients, Although Many Don’t Have Covid””

Μέσα στο τμήμα επειγόντων περιστατικών στο Sparrow Hospital στο Λάνσινγκ του Michigan, τα μέλη του προσωπικού αγωνίζονται να φροντίσουν τους ασθενείς που εμφανίζονται πολύ πιο άρρωστοι από ό,τι έχουν δει ποτέ.

Η Tiffani Dusang, η διευθύντρια νοσηλευτικής του ER, έχει κυριευτεί από συγκρατημένο άγχος, κοιτάζοντας ασθενείς που βρίσκονται σε μια μεγάλη σειρά από φορεία στριμωγμένα στους μπεζ τοίχους των διαδρόμων του νοσοκομείου. «Είναι δύσκολο να το βλέπεις»,

Αλλά δεν μπορεί να κάνει τίποτα. Τα 72 δωμάτια του ER είναι ήδη γεμάτα.

Μπορεί κάποιος να εξηγήσει γιατί συμβαίνει αυτό;

Εάν ο αριθμός των κρουσμάτων COVID-19 άρχιζε να αυξάνεται ξανά, θα ήταν λογικό να ξεχειλίζουν τα δωμάτια έκτακτης ανάγκης.

Αλλά στο συγκεκριμένο νοσοκομείο στο Michigan, μας λένε ότι μερικά από τα κύρια πράγματα που αντιμετωπίζονται περιλαμβάνουν «κοιλιακό άλγος», «αναπνευστικά προβλήματα», «θρόμβους αίματος» και «καρδιακές παθήσεις»…

Οι μήνες καθυστερήσεων της θεραπείας έχουν επιδεινώσει τις χρόνιες παθήσεις και έχουν επιδεινώσει τα συμπτώματα. Γιατροί και νοσηλευτές λένε ότι οι ασθένειες αφορούν σε κοιλιακό άλγος, αναπνευστικά προβλήματα, θρόμβους αίματος, καρδιακές παθήσεις και απόπειρες αυτοκτονίας, μεταξύ άλλων καταστάσεων.

Αυτή η αναφορά στις «καρδιακές παθήσεις» τράβηξε αμέσως την προσοχή μου, γιατί το βλέπω τόσο πολύ στις ειδήσεις τελευταία.

Για παράδειγμα, ένας τελειόφοιτος γυμνασίου στην Pennsylvania μόλις έπεσε νεκρός από «ένα ξαφνικό καρδιακό επεισόδιο»…

Ο νεαρός «απόλαυσε πολύ» τη νίκη της ομάδας του στο πρωτάθλημα το Σάββατο. Αργότερα το ίδιο βράδυ, ήταν νεκρός.

Τώρα, το γυμνάσιο του αείμνηστου μαθητή Blake Barklage-photo κάτω, θρηνεί τον πρόωρο θάνατό του. Όπως αναφέρει το 6ABC στο Philly, η τραγωδία σημειώθηκε στο γυμνάσιο του κολλεγίου La Salle στην κομητεία Μοντγκόμερι της Πενσιόν.

Σε επιστολή προς τους γονείς, το σχολείο ανακοίνωσε ότι ο μαθητής πέθανε μετά από «ξαφνικό καρδιακό επεισόδιο» το βράδυ του Σαββάτου.

Ο Blake Barklage

Στην ίδια πολιτεία υπάρχει και άλλο παρόμοιο περιστατικό: Ένα κατά τα άλλα υγιές αγόρι 12 ετών πέθανε ξαφνικά εξαιτίας ενός προβλήματος με τη στεφανιαία αρτηρία του…

Η οικογένεια και οι φίλοι θρηνούν για το 12χρονο που έφυγε από τη ζωή ενώ έκανε προθέρμανση για προπόνηση σχολικού μπάσκετ.

Όπως αναφέρει το TribLive στο Pittsburgh, ο Jayson Kidd, 12 ετών, από το Bridgeville, Pa., πέθανε από φυσικά αίτια που αφορούσαν τη στεφανιαία αρτηρία του, σύμφωνα με το ιατροδικαστικό γραφείο της κομητείας Allegheny.
Τα καρδιακά προβλήματα σκοτώνουν τους ηλικιωμένους συνεχώς, αλλά είναι περίεργο που τόσοι πολλοί υγιείς νέοι έχουν αυτά τα προβλήματα.

Πρόσφατα ο επιθετικός της Barcelona, Sergio Aguero, κατέρρευσε ξαφνικά στον αγωνιστικό χώρο κατά τη διάρκεια ενός αγώνα.

Αργότερα διαγνώστηκε με «καρδιακή αρρυθμία”.

Μόλις δύο μέρες αργότερα, ένας αγώνας στη Νορβηγία διακόπηκε, αφού ένας παίκτης υπέστη «καρδιακή ανακοπή» ακριβώς στη μέση ενός αγώνα…

Ένας ποδοσφαιρικός αγώνας στη δεύτερη κατηγορία της Νορβηγίας διακόπηκε τη Δευτέρα αφού ο Ισλανδός μέσος Emil Pálsson υπέστη καρδιακή ανακοπή κατά τη διάρκεια του αγώνα.

Ο 28χρονος παίκτης του Sogndal υπέστη την ανακοπή καθώς ο αγώνας εναντίον της Stjordals-Blink μπήκε στο 12ο λεπτό, ανέφερε η ομάδα του σε ανακοίνωση.

Έχω δει τόσες πολλές ιστορίες όπως αυτή.

Γιατί λοιπόν τόσοι πολλοί νέοι έχουν ξαφνικά τόσο σοβαρά προβλήματα με την καρδιά τους;

Μπορεί κάποιος εκεί έξω να μου το εξηγήσει αυτό;

Απάντηση Γιώργος Ευαγγελάτος: Δεν ξεκαθαρίζετε αν όλοι αυτοί που εμφανίζουν ανακοπές, εμφράγματα, ιδιαίτερα οι νέοι έχουν κάνει το μπόλι. Αν το έχουν κάνει είναι πολύ εύκολο τότε είναι αρκετό να καταλήξει κανείς στο συμπέρασμα ότι οι πρωτεΐνες της ακίδας όπως υποστηρίζει και ο ειδικός ιολόγος Siharut Bhagdi εισέρχεται στο ενδοθήλιο των αγγείων και προκαλεί τα περισσότερα από τα πιο πάνω αναφερθέντα συμβάματα. Αν δεν έχουν εμβολιαστεί καλόν είναι να ερευνηθεί αν είχαν προσβληθεί στο παρελθόν από τον Covid-19 και οι θάνατοι συνδέονται με αυτόν ή με άλλα νοσήματα που μπορεί να συνυπήρχαν ή να επιδεινώθηκαν εξ αιτίας του.

ΠΗΓΗ:https://kourdistoportocali.com/news-desk/ektakto-gt-israilinoi-epistimones-anoixan-to-mayro-koyti-tis-covid-19-deite-ta-ekpliktika-eyrimata-eno-stis-ipa-xafnika-oi-entatikes-gemizoyn-me-ragismenes-kardies-neon/

Ισραηλινή μελέτη. Με 15 δολάρια παίρνοντας φαινοφιμπράτη γλυτώνεις τη διασωλήνωση από Covid-19

14 στους 15 ασθενείς με σοβαρή νόσηση, οι οποίοι έλαβαν θεραπεία του φαρμάκου TriCor, δεν χρειάστηκαν υποστήριξη οξυγόνου και εξήλθαν του νοσοκομείου εντός μίας εβδομάδας

Σύμφωνα με μία νέα μελέτη του Hebrew University, στο Ισραήλ, δεκατέσσερις στους 15 ασθενείς με σοβαρή νόσηση από επιπλοκές COVID-19, οι οποίοι έλαβαν θεραπεία του φαρμάκου TriCor (φαινοφιμπράτη), δεν χρειάστηκαν υποστήριξη οξυγόνου και εξήλθαν του νοσοκομείου εντός μίας εβδομάδας.

Η φαινοφιβράτη είναι ένα φάρμακο εγκεκριμένο από το FDA (και τον ΕΟΦ) λαμβάνεται από το στόμα. Τα αποτελέσματα της κλινικής μελέτης είναι ήδη στο στάδιο της έρευνας και επί του παρόντος βρίσκονται υπό αξιολόγηση από τους επιστήμονες.

Συγκεκριμένα, η ομάδα, υπό τον καθηγητή του πανεπιστημίου Yaakov Nahmias, πραγματοποίησε τη μελέτη στο Barzilai Medical Center του Ισραήλ σε συντονισμό με τον επικεφαλής του νοσοκομείου της Μονάδας Λοιμωδών Νοσημάτων, Καθ. Shlomo Maayan και με την υποστήριξη των εργαστηρίων Abbott.

Οι 15 ασθενείς που έλαβαν τη θεραπεία παρουσίασαν πνευμονία και χρειάζονταν υποστήριξη οξυγόνου. Ήταν επίσης ηλικιωμένοι με πολλαπλές συννοσηρότητες, από διαβήτη και παχυσαρκία έως υψηλή αρτηριακή πίεση. Εκτός από το πρωτόκολλο περίθαλψης, δόθηκε στους ασθενείς 145 mg/ημέρα φαινοφιβράτης για 10 ημέρες.

«Τα αποτελέσματα ήταν άμεσα», ανέφερε ο Nahmias στην The Jerusalem Post. «Οι προοδευτικοί δείκτες φλεγμονής, οι οποίοι αποτελούν το σήμα κατατεθέν της επιδεινωτικής COVID-19, μειώθηκαν εντός 48 ωρών από τη θεραπεία. Επιπλέον, 14 από τους 15 ασθενείς δεν χρειάστηκαν τελικά υποστήριξη οξυγόνου. Ο 15ος βγήκε από το οξυγόνο εντός 10 ημερών. Κατά τη σύγκριση δεδομένων σε σχέση με άλλους ασθενείς, ένα ποσοστό μικρότερο από το 30%, κατά μέσο όρο, αποσωληνόνονται σε μια εβδομάδα. Με άλλα λόγια, η φαινοφιμπράτη θα μπορούσε να μειώσει δραματικά τον χρόνο θεραπείας για ασθενείς με σοβαρή COVID.

Γνωρίζουμε ότι η νόσηση σε τέτοιου είδους ασθενείς επιδεινώνεται πολύ γρήγορα, αναπτύσσουν καταγισμό κυτοκινών σε πέντε έως επτά ημέρες και μπορεί να χρειαστούν εβδομάδες για τη θεραπεία τους προκειμένου να γίνουν καλύτερα», είπε ο Yaakov Nahmias. «Δώσαμε σε αυτούς τους ασθενείς φαινοφιμπράτη και η μελέτη δείχνει ότι η φλεγμονή μειώθηκε απίστευτα γρήγορα. Φαίνεται ότι δεν ανέπτυξαν καταιγισμό κυτοκινών σε κανένα σημείο».

Σε γενικές γραμμές, οι ασθενείς που δεν χρειάζονται οξυγόνο μπορούν να θεραπευτούν στο σπίτι, συμπλήρωσε ο ίδιος. «Επιπλέον, παρά τον υψηλό αριθμό θανάτων από COVID στο Ισραήλ και στο εξωτερικό, η πλειοψηφία των βαριά ασθενών επιβιώνουν. Αν κοιτάξετε την περίοδο των 28 ημερών, θα περίμενα ότι όλοι θα επιβιώσουν με ή χωρίς το φάρμακο», εξήγησε ο Nahmias. «Το ερώτημα είναι πόσο γρήγορα μπορούμε να τους πάμε σπίτι ή πόσο γρήγορα μπορούμε να οδηγήσουμε έναν σοβαρό ασθενή σε ήπια κατάσταση».

Όλοι οι ασθενείς της μελέτης ολοκλήρωσαν τη θεραπεία 10 ημερών στο σπίτι, μετά την έξοδο τους από το νοσοκομείο και, σύμφωνα με τον Maayan, «δεν αναφέρθηκαν ανεπιθύμητες ενέργειες που σχετίζονται με το φάρμακο».

Το FENOFIBRATE εγκρίθηκε από τον FDA το 1975 για μακροχρόνια χρήση και θεωρείται ασφαλές. Επιπλέον, είναι ένα φθηνό χάπι, είπε ο Yaakov Nahmias. Επιπλέον, η θεραπεία κοστίζει λιγότερο από 1,50 δολάριο την ημέρα, κάτι που σημαίνει ότι η συνολική θεραπεία ανά ασθενή είναι περίπου 15 δολάρια.

Ο Nahmias μελετά τη χρήση της φαινοφιβράτης για τη θεραπεία της COVID-19 σχεδόν από την αρχή της πανδημίας. Έκανε πρώτα μια προκλινική δοκιμή και στη συνέχεια μια πολυκεντρική αναδρομική μελέτη. Και οι δύο έδειξαν θετικότατα αποτελέσματα σχετικά με την αποτελεσματικότητα του φαρμάκου.

«Οι ιοί είναι παράσιτα», εξήγησε ο Yaakov Nahmias. «Δεν μπορούν να αναπαραχθούν μόνοι τους. Πρέπει να μπουν μέσα σε ένα ανθρώπινο κύτταρο, να καταλάβουν τα συστήματα τους και να αναπαραχθούν».
Σε συνεργασία με επιστήμονες στις Ηνωμένες Πολιτείες, ο καθηγητής απέδειξε ότι ο κορωναϊός εμποδίζει την καύση λίπους στα πνευμονικά κύτταρα, με αποτέλεσμα να συσσωρεύονται μεγάλες ποσότητες τους μέσα στα πνευμονικά κύτταρα, μία κατάσταση που δημιουργείται προκειμένου να αναπαραχθεί ο ιός. Η φαινοφιμπράτη, ελπίζει, ότι θα αντιστρέψει αυτό το αποτέλεσμα και θα εξαλείψει την αντιγραφή του ιού.

«Κατανοώντας τον τρόπο με τον οποίο ο SARS-CoV-2 ελέγχει τον μεταβολισμό μας, μπορούμε να καταπολεμήσουμε τον ιό και να του στερήσουμε τους πόρους που χρειάζεται για να επιβιώσει», δήλωσε ο Yaakov Nahmias στην Post, σημειώνοντας ότι μπορεί επίσης να εξηγήσει γιατί οι ασθενείς με υψηλά επίπεδα σακχάρου στο αίμα και χοληστερόλης αποτελούν ασθενείς με υψηλό κίνδυνο εμφάνισης COVID-19.

Ο καθηγητής ασχολείται τώρα με μια σειρά μελετών Φάσης ΙΙΙ που διεξάγονται στη Νότια Αμερική, τις Ηνωμένες Πολιτείες και το Ισραήλ. Αυτές οι μελέτες είναι ελεγχόμενες με εικονικό φάρμακο και διπλά τυφλές. Ο Yaakov Nahmias ανέφερε ότι η ομάδα του προσπαθούσε να εγγράψει ασθενείς στη μελέτη πριν από την εμφάνιση της παραλλαγής Delta, αλλά οι προσπάθειες τώρα προχωρούν πιο γρήγορα. Ελπίζει ότι τα αποτελέσματα θα είναι διαθέσιμα ήδη μέσα στους επόμενους δύο μήνες.

Εν τω μεταξύ, το φάρμακο είναι διαθέσιμο και οι γιατροί μπορούν να αποφασίσουν αν θα χορηγήσουν θεραπεία με βάση τα διαθέσιμα δεδομένα. «Δεν υπάρχουν ασημένιες σφαίρες», είπε, «αλλά η φαινοφιβράτη είναι πολύ ασφαλέστερη από άλλα φάρμακα που έχουν προταθεί μέχρι σήμερα και ο μηχανισμός δράσης της δεν φαίνεται να επηρεάζεται ιδιαίτερα από τις παραλλαγές».

ΠΗΓΗ:https://kourdistoportocali.com/news-desk/diaole-kai-allo-farmako-gt-me-15-dolaria-glytoneis-ti-diasolinosi-apo-covid-19/

Η fenofibrate φαίνεται να μειώνει την Α και Β μετάλλαξη του Covid-19

Study finds fenofibrate’s ability to reduce Covid-19 infection

09 Aug 2021

Fenofibrate[1] also demonstrated efficacy against the newly emergent alpha and beta variants of SARS-CoV-2 in the study.

A research team led by the University of Birmingham and Keele University in the UK has found that a licensed oral drug, fenofibrate, and its active form, fenofibric acid, can substantially reduce SARS-CoV-2 infection in human cells in the laboratory.

Approved in various countries, fenofibrate is being used for the treatment of conditions such as increased cholesterol and fatty substance levels in the blood.

Fenofibrate decreased Covid-19 infection by up to 70% at concentrations that are safe and attainable with its standard clinical dose, the University of Birmingham noted.

Led by the San Raffaele Scientific Institute in Italy, the research was conducted in partnership with the University of Copenhagen in Denmark and the University of Liverpool, UK.

In the study, researchers analysed a panel of presently licensed drugs, including fenofibrate, to detect candidates that can interrupt angiotensin-converting enzyme 2 (ACE2) and Spike interactions.

Fenofibrate was selected and assessed for efficacy in reducing infection in cells in the laboratory with the use of the SARS-CoV-2 original strains isolated last year.

Furthermore, additional unpublished findings showed that the drug worked against the newly emergent SARS-CoV-2 variants such as the Alpha and Beta variants.

The university added that further research is underway to analyse the drug’s efficacy against the Delta variant.

Πηγή:https://www.clinicaltrialsarena.com/news/study-fenofibrate-covid-infection/

[1]Η φαινοφιβράτη (fenofibrate) είναι ένα παράγωγο του ινικού οξέος, του οποίου η δράση να μεταβάλλει τα επίπεδα των λιπιδίων στον άνθρωπο μεσολαβείται με ενεργοποίηση του υποδοχέα PPARα. Μέσω της ενεργοποίησης του PPARα, η φαινοφιβράτη αυξάνει τη λιπόλυση και την αποβολή των αθηρογόνων πλούσιων σε τριγλυκερίδια σωματίων από το πλάσμα ενεργοποιώντας τη λιποπρωτεϊνική λιπάση και μειώνοντας την παραγωγή της αποπρωτεΐνης C-III.

Ο Νεόφυτος Μόρφου εντέλλεται <<μη βιαστείτε να τσιμπηθείτε!>>

Ο επίσκοπος Μόρφου παραπέμπει Διοικούσα Εκκλησία και πιστό λαό να σεβαστεί την Χάρτα των Ανθρωπίνων Δικαιωμάτων και να σταματήσει να διχάζει τον λαό του Κυρίου επιμένοντας στον υποχρεωτικό εμβολιασμό και την επιβολή των πιστών σε rapid test προ του εκκλησιασμού τους.

ΟΙΚΟΥΜΕΝΙΚΗ ΔΙΑΚΗΡΥΞΗ ΤΩΝ ΑΝΘΡΩΠΙΝΩΝ ΔΙΚΑΙΩΜΑΤΩΝ

Επίσημο Έγγραφο

ΠΡΟΟΙΜΙΟ

Επειδή η αναγνώριση της αξιοπρέπειας, που είναι σύμφυτη σε όλα τα μέλη της ανθρώπινης οικογένειας, καθώς και των ίσων και αναπαλλοτρίωτων δικαιωμάτων τους, αποτελεί το θεμέλιο της ελευθερίας, της δικαιοσύνης και της ειρήνης στον κόσμο,

Επειδή η παραβίαση και η περιφρόνηση των δικαιωμάτων του ανθρώπου οδήγησαν σε πράξεις βαρβαρότητας, που εξεγείρουν την ανθρώπινη συνείδηση, και η προοπτική ενός κόσμου όπου οι άνθρωποι θα είναι ελεύθεροι να μιλούν και να πιστεύουν, λυτρωμένοι από τον τρόμο και την αθλιότητα, έχει διακηρυχθεί ως η πιο υψηλή επιδίωξη του ανθρώπου,

Επειδή έχει ουσιαστική σημασία να προστατεύονται τα ανθρώπινα δικαιώματα από ένα καθεστώς δικαίου, ώστε ο άνθρωπος να μην αναγκάζεται να προσφεύγει, ως έσχατο καταφύγιο, στην εξέγερση κατά της τυραννίας και της καταπίεσης,

Επειδή έχει ουσιαστική σημασία να ενθαρρύνεται η ανάπτυξη φιλικών σχέσεων ανάμεσα στα έθνη,

Επειδή με τον Καταστατικό Χάρτη, οι λαοί των Ηνωμένων Εθνών διακήρυξαν και πάλι την πίστη τους στα θεμελιακά δικαιώματα του ανθρώπου, στην αξιοπρέπεια και την αξία της ανθρώπινης προσωπικότητας, στην ισότητα δικαιωμάτων ανδρών και γυναικών, και διακήρυξαν πως είναι αποφασισμένοι να συντελέσουν στην κοινωνική πρόοδο και να δημιουργήσουν καλύτερες συνθήκες ζωής στα πλαίσια μιας ευρύτερης ελευθερίας,

Επειδή τα κράτη μέλη ανέλαβαν την υποχρέωση να εξασφαλίσουν, σε συνεργασία με τον Οργανισμό των Ηνωμένων Εθνών, τον αποτελεσματικό σεβασμό των δικαιωμάτων του ανθρώπου και των θεμελιακών ελευθεριών του ανθρώπου σε όλο τον κόσμο,

Επειδή η κατανόηση από όλους, αυτών των δικαιωμάτων και ελευθεριών, έχει εξαιρετική σημασία για να εκπληρωθεί πέρα ως πέρα αυτή η υποχρέωση,

Διά ταύτα,

Η Γενική Συνέλευση,

Διακηρύσσει ότι η παρούσα Οικουμενική Διακήρυξη των Δικαιωμάτων του Ανθρώπου αποτελεί το κοινό ιδανικό στο οποίο πρέπει να στοχεύουν όλοι οι λαοί και όλα τα έθνη, έτσι ώστε κάθε άτομο και κάθε όργανο της κοινωνίας, με τη Διακήρυξη αυτή διαρκώς στη σκέψη, να καταβάλλει, μέσα από τη διδασκαλία και την παιδεία, σε εθνικό και διεθνές επίπεδο, κάθε προσπάθεια για να αναπτυχθεί ο σεβασμός των δικαιωμάτων και των ελευθεριών αυτών, και να εξασφαλιστεί προοδευτικά η παγκόσμια και αποτελεσματική εφαρμογή τους, τόσο ανάμεσα στους λαούς των ίδιων των κρατών μελών, όσο και ανάμεσα στους πληθυσμούς χωρών που βρίσκονται στη δικαιοδοσία τους.

http://https://www.youtube.com/watch?v=gfpMgk57Jdo

Πλησιάζει η ημέρα της Κρίσης; Τι κρύβεται πίσω από την πανδημία και τον φόβο της κλιματικής αλλαγής1

Πρώτη εκδοχή, η μείωση του πληθυσμού

ώστε να σωθεί η Ελίτ κατοικώντας στα παλάτια της, εγκαθιστάμενη στα ψηλότερα μέρη τη γης αφού το ζωώδες πλήθος δεν θα έχει απαίτηση ιδιοκτησίας και περιουσίας. Όλες οι απομένουσες εκτάσεις θα είναι δικές τους

Όσοι δε βλέπουν ότι έφτασε ο κόμβος στο χτένι με την άθλια προπαγάνδα του Διευθυντηρίου που επιβάλει κάτω από την έμπνευση του ίδιου  του Εωσφόρου και των λεγεώνων του παγκόσμια υποταγή και απομείωση της ανθρωπότητας με την πρόφαση ενός σκόπιμα κατασκευασμένου βιολογικού όπλου που επίτηδες διεσπάρη στα πέρατα του πλανήτη και μιας ομάδας φαρμακευτικών σκευασμάτων τα οποία προκαλούν ακόμη μεγαλύτερες παρενέργειες και μέσο-μακροπρόθεσμες  βλάβες, παραλύσεις, άνοια, νόσο του Parkinson, (βλέπε παλαιότερη ανάρτηση μας της Stefani Seneff με βιβλιογραφικές αναφορές 45 ερευνητών) κορύφωση των καρκίνων και των αυτοανόσων νόσημάτων, είναι τυφλός και κουφός και άξιος της μοίρας του.

Κάθε νοήμων άνθρωπος μπορεί να παρατηρήσει ότι κατά τη διάρκεια των εγκλεισμών των πολιτών με τη δικαιολογία του περιορισμού της διασποράς της ασθένειας Covid-19, οι κυβερνήσεις της Δύσης, καταπληκτικά συντονισμένες (αφού υπακούν στα ίδια αφεντικά) να εκτελούν κοινές εντολές, να ενσωματώνουν όλοι στις εθνικές τους νομοθεσίες διατάξεις για τον περιορισμό της εξάπλωσης της δήθεν πανδημίας, της ενεργειακής κατανάλωσης και ευρύτερα νόμους για την κρατικοποίηση της ιδιωτικής περιουσίας και την φτωχοποίηση των πολιτών. Είναι το αφήγημα το κορωνοϊού μια άσκηση ετοιμότητας για την υποδούλωση των ανθρώπων με τη δικαιολογία της κλιματικής «απειλής» ή μήπως η απειλή είναι φυσική, και θα μας χτυπήσει σύντομα;

Σήμερα, βλέπουμε ότι μία προς μία οι προειδοποιήσεις της ταινίας Interstellar επαληθεύονται:

Τα μεταλλαγμένα τρόφιμα, η γεωμηχανική, η πανδημία, η διάλυση της δημόσιας παιδείας και υγείας, οι γιγάντιες σκονοθύελλες που ενσκήπτουν διαρκώς στις ΗΠΑ και στην Αυστραλία, και τέλος οι μαζικοί εμπρησμοί δασών και οικιών (που μπορεί να γίνονται ακόμα και από drones ή από όπλα λέιζερ όπως η Καλλιόπη Σουφλή και ο Τουρναβίτης διατείνονται ότι συνέβη στις πυρκαγιές στο Μάτι) δολοφονούν ανθρώπους ή τους στερούν τη περιουσία τους.

Μένει να δούμε σκονοθύελλες και στην Ευρώπη και να γίνουν γνωστές αφού αποκαλυφθούν οι υπόγειες βάσεις της NASA με εξέδρες διαστημοπλοίων, για να πειστούν και οι πιο δύσπιστοι, αλλά αυτό το τελευταίο μάλλον δεν θα το δούμε ποτέ.

Η θηριώδης σκονοθύελλα του Τέξας, 5.6.2019.

Στυγνή υποδούλωση μέσω μεγάλης ληστείας

Η δεύτερη εκδοχή είναι πως η ηγεσία του Νταβός και των υπόλοιπων συγκοινωνούντων δοχείων γνωρίζει μεν ότι σίγουρα θα συμβεί μετατόπιση πόλων που θα φέρει κατακλυσμό και εν συνεχεία νέα εποχή παγετώνων, αλλά έχει στοιχεία ότι θα αργήσει κάτι τέτοιο.

Γι’ αυτό και το Διευθυντήριο (ή Καμπάλ) προχωράει ακάθεκτη στο σχέδιο δραστικής μείωσης των 2/3 του πληθυσμού με τους τρόπους που προαναφέρθηκαν.

Σε κάθε περίπτωση, τα μέλη του Νταβός έχουν όλα αγοράσει πλήρως εξοπλισμένες για αυτάρκεια εκτάσεις στην ενδοχώρα των ΗΠΑ και στη Νέα Ζηλανδία που περιλαμβάνουν και υπόγεια μπούνκερ που μπορούν να στεγάσουν και κοπάδια ζώων για ένα διάστημα.

Τι να κάνουμε;

Είτε το ένα συμβαίνει, είτε το άλλο, οφείλουμε να επιβιώσουμε με κάθε τρόπο. Προς το παρόν μπορούμε να υιοθετήσουμε τα εξής:

1. Πλήρη εξοβελισμό κάθε συστημικού ΜΜΕ.Δεν παρακολουθούμε τις απατηλές ειδήσεις που σπέρνουν τρομοκρατία και φόβο.

Αδιαφορία και περιφρόνηση της προσπάθειας ελέγχου και διασποράς της κατεστημένης πληροφόρησης. Αγώνας για την όσο το δυνατόν γνήσια και διαφανή διασταυρούμενη πληροφορία, για όσο καιρό θα λειτουργούν μη καθεστωτικά ιστολόγια. Διασπείροντας την πληροφορία, μία κρίσιμη μάζα ανθρώπων δεν θα αργήσει να αντιληφθεί ότι η φυσική κλιματική υπερθέρμανση και η μετεωρολογική αστάθεια χρησιμοποιείται σαν όπλο υποδούλωσής της από μια χούφτα ανήθικων ανθρώπων που την εκμεταλλεύονται.

2. Απόρριψη κάθε αφηγήματός τους περί ανίκητων και αιμοβόρων δήθεν ερπετοειδών εξωγήινων ή εσωγήινων οντοτήτων, καθώς και της μοιρολατρικής αντίληψης περί θείας επεμβάσεως, χριστιανών αγίων που θα μας σώσουν, ή μετενσαρκωμένου βυζαντινού αυτοκράτορα Βατάτζη σε χασομέρη γόνο γερμανο-εβραίων γαλαζοαίματων που είναι πολύ πιθανόν ότι θα ηγηθεί των Ελλήνων, δήθεν για να απελευθερώσει τη χώρα μας.

 Τέτοιου είδους ψυχολογικές επιχειρήσεις πολέμου (ΨΕΠ) απονευρώνουν και παραλύουν κάθε αντίσταση και παραδίδουν τις τύχες μας στα χέρια των εχθρών μας.
 Μόνο φαντασιοκόποι και παραλυμένοι από το φόβο και τον τρόμο στα συμβαίνοντα και μελλοντικά αποκαλυπτικά γεγονότα που έρχονται μπορούν αδρανοποιημένοι και αξιολύπητοι να διακηρύττουν. Αδιαφορείστε και βάλτε τους στο περιθώριο

3. Παραδειγματική τιμωρία των υπευθύνων για τα εγκλήματά τους (πριν αποδράσουν με το ελικόπτερο ή πριν μας ξεκάνουν όλους).


4. Ανυπακοή στις άνομες διαταγές τους, απεργίες διαρκείας 2 ή τριών μηνών μέχρι να καταρρεύσουν οι δολοφόνοι των λαών, μαζική συσπείρωση και οργάνωση τρόπων επιβίωσης.

Οι πραγματικοί Έλληνες οφείλουν να ενωθούν και  επιβιώσουν με κάθε τρό,πο για να συντρίψουν τους δαιμονοκατειλημμένους ηγέτες μας που μας έχουν φέρει σε ρήξη με τον Δημιουργό Θεό μας όπως λέει ένας βουδιστής, αλλά σοφός ιατρός, ιολόγος, ερευνητής ο Siharut Bhakdi.

Το άρθρο είναι εμπνευσμένο από μια ανάρτηση της ΑΠΕΡΟΠΙΑΣ.

Ευαγγελάτος Γεώργιος

Η μετάφραση κατά το μάλλον και ήττον του προηγούμενου άρθρου από το περιοδικό viruses

Μετά από αυτό το άρθρο τρέξετε να τσιμπηθείτε, έτσι κι αλλιώς ό,τι σας λέγουν νηφάλιοι ερευνητές δεν σας αρκεί.

Εμβόλια κατά Covid-19: Οι πρωτεΐνες ακίδας προκαλούν τον όλεθρο στον μηχανισμό επιδιόρθωσης του DNA - Έρευνα τρόμος

Covid-19: Οι πρωτεΐνες ακίδας του προκαλούν άμεση χειροτέρευση κι επιβράδυνση στον μηχανισμό επιδιόρθωσης του DNA και κατ’ επέκταση το ίδιο κάνουν οι πρωτεΐνες ακίδας των jabs (τσιμπημάτων)

Αν πράγματι ισχύουν τα όσα υποστηρίζει η έρευνα τότε τα πράγματα είναι δύσκολα

Μια έρευνα σοβαρή έως ανησυχητική, δημοσιεύθηκε στο περιοδικό Viruses η οποία αναφέρεται στα όσα προκαλούν τα εμβόλια κατά του κορωνοϊού και συγκεκριμένα η πρωτεΐνη ακίδας.

Σύμφωνα με την έρευνα οι πρωτεΐνες ακίδας του εμβολίου εισέρχονται στους κυτταρικούς πυρήνες και προκαλούν τον όλεθρο στον μηχανισμό επιδιόρθωσης του DNA των κυττάρων, καταστέλλοντας την επιδιόρθωση του DNA έως και 90%.

Η ερευνητική εργασία τιτλοφορείται, «SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In vitro» και έχει συγγραφεί από τους Hui Jiang και Ya-Fang Mei.

Αναλυτικά τα όσα αναφέρει 

Στο συμπέρασμα της εργασίας, οι συγγραφείς γράφουν χαρακτηριστικά: «Βρήκαμε ότι η πρωτεΐνη ακίδας ανέστειλε σημαντικά τον σχηματισμό εστιών BRCA1 και 53BP1 (Εικόνα 3D–G). Μαζί, αυτά τα δεδομένα δείχνουν ότι η πρωτεΐνη ακίδας SARS-CoV-2 αναστέλλει την επιδιόρθωση της βλάβης του DNA παρεμποδίζοντας την στρατολόγηση πρωτεϊνών επισκευής DNA».

Ο μηχανισμός επιδιόρθωσης του DNA, γνωστός ως NHEJ (non-homologous end joining) είναι ένα είδος ενδοκυττάριου συστήματος «απόκρισης έκτακτης ανάγκης» που επιδιορθώνει τις θραύσεις των δύο κλώνων του DNA. Χωρίς τον μηχανισμό NHEJ (non-homologous end joining), όλη η προηγμένη πολυκυτταρική ζωή θα έπαυε να υπάρχει. Κανένας άνθρωπος, ζώο ή φυτό δεν θα μπορούσε να επιβιώσει χωρίς αυτόν.

Βλάβη στο DNA μπορεί να προκληθεί από έκθεση σε ακτινοβολία, χημικές ουσίες που βρίσκονται σε τρόφιμα και προϊόντα προσωπικής φροντίδας ή ακόμα και από έκθεση σε εξοπλισμό μαστογραφίας. Η υπερβολική έκθεση στο ηλιακό φως μπορεί επίσης να προκαλέσει θραύση του DNA.

Σε ένα φυσιολογικό, υγιές άτομο, ο μηχανισμός NHEJ επιδιορθώνει το DNA και αποτρέπει την εμφάνιση παθογόνου μετάλλαξης. Αλλά με την παρουσία της πρωτεΐνης ακίδας του εμβολίου, η αποτελεσματικότητα του NHEJ καταστέλλεται έως και 90% , που σημαίνει ότι δεν μπορεί να κάνει τη δουλειά του λόγω της κατασταλμένης ικανότητας να στρατολογεί πρωτεΐνες για επισκευή.

Ως αποτέλεσμα, τα ακόλουθα «λάθη» εισάγονται στα χρωμοσώματα, μέσα στους πυρήνες των ανθρώπινων κυττάρων, όλα λόγω της παρουσίας της πρωτεΐνης ακίδας από τα εμβόλια mRNA:

  • Μεταλλάξεις ή «λάθη» στην γενετική αλληλουχία.
  • ΔΙΑΓΡΑΦΕΣ ολόκληρων τμημάτων γενετικού κώδικα.
  • ΕΙΣΑΓΩΓΕΣ λανθασμένων τμημάτων.
  • Ανάμειξη και αντιστοίχιση / μεταθέσεις γενετικού κώδικα.

Αυτά τα σφάλματα, όταν εκφράζονται μέσω της κυτταρικής διαίρεσης και αντιγραφής, έχουν ως αποτέλεσμα:

  • Μια έκρηξη καρκίνου και καρκινικών όγκων σε όλο το σώμα
  • Απώλεια παραγωγής των Β και Τ κυττάρων του ανοσοποιητικού συστήματος (δηλ. επαγόμενη ανοσοανεπάρκεια)
  • Αυτοάνοσες διαταραχές
  • Επιτάχυνση της γήρανσης και μειωμένο μήκος τελομερών
  • Απώλεια λειτουργίας σύνθετων οργανικών συστημάτων όπως κυκλοφορικό, νευρολογικό, ενδοκρινικό, μυοσκελετικό κ.λπ.
  • Κυτταρική βλάβη που μοιάζει με δηλητηρίαση από ακτινοβολία καθώς τα κύτταρα καταστρέφονται από μέσα

Ο Δρ Thomas Levy γράφει για την τοξικότητα της πρωτεΐνης ακίδας στο Orthomolecular.org

Έχει δημιουργηθεί ανησυχία σχετικά με την διάδοση της πρωτεΐνης ακίδας σε όλο το σώμα μετά τον εμβολιασμό. Αντί να παραμένει εντοπισμένη στο σημείο της ένεσης προκειμένου να προκληθεί η ανοσολογική απόκριση και τίποτα περισσότερο, η παρουσία πρωτεΐνης ακίδας έχει ανιχνευθεί σε όλο το σώμα ορισμένων εμβολιασμένων ατόμων. Πιο ανησυχητικά, ο Δρ Levy εξηγεί ότι τα τρέχοντα στοιχεία δείχνουν ότι η πρωτεΐνη ακίδας συνεχίζει να παράγεται στο σώμα, μετά την αρχική ένεση mRNA.

Η πρωτεΐνη ακίδας πλήρους μήκους είχε ως αποτέλεσμα την μεγαλύτερη καταστολή του μηχανισμού επιδιόρθωσης του DNA NHEJ

Δείτε τα παρακάτω σχήματα. Τα ιικά θραύσματα του SARS-CoV-2 ονομάζονται «Nsp1, Nsp5» και ούτω καθεξής. Η ακίδα πλήρους μήκους ονομάζεται “Spike” και το νουκλεοκαψίδιο – ένα άλλο δομικό μέρος ολόκληρου του παθογόνου πρωτεΐνης ακίδας – προσδιορίζεται ξεχωριστά.

Από την μελέτη:

Η υπερέκφραση των πρωτεϊνών Nsp1, Nsp5, Nsp13, Nsp14 και ακίδας μείωσε την αποτελεσματικότητα τόσο της επισκευής HR όσο και της NHEJ (Εικόνα 1B–E και Εικόνα S2A,B).

Τα Σχήματα Γ και Ε δείχνουν την καταστολή της επιδιόρθωσης NHEJ από αυτά τα διάφορα τμήματα ιικών θραυσμάτων. (Δείτε τις μπλε κάθετες γραμμές γραφήματος που αντιπροσωπεύουν τα επίπεδα δραστηριότητας / απόδοσης του μηχανισμού επιδιόρθωσης DNA).

Αυτό που δείχνουν αυτά τα δεδομένα είναι ότι η μεγαλύτερη καταστολή της δραστηριότητας NHEJ μετράται όταν υπάρχει η πλήρης πρωτεΐνη ακίδας.

Από τη μελέτη: Μαζί, αυτά τα δεδομένα δείχνουν ότι η πρωτεΐνη ακίδας πλήρους μήκους SARS-CoV-2 αναστέλλει την επιδιόρθωση βλάβης στο DNA παρεμποδίζοντας τη στρατολόγηση πρωτεϊνών επισκευής DNA.

Αυτή είναι η πρωτεΐνη ακίδας που παράγεται από τα ίδια τα κύτταρα του σώματος μετά την ένεση με ένα εμβόλιο mRNA:

Στο σχήμα 2, παρακάτω, βλέπετε ότι η καταστολή της δραστηριότητας NHEJ παρουσιάζει μια δοσοεξαρτώμενη απόκριση στην παρουσία πρωτεΐνης ακίδας (σχήματα 2Β και 2C). Αυτό δείχνει ότι όσο περισσότερες πρωτεΐνες είναι παρούσες, τόσο μεγαλύτερη είναι η καταστολή της επιδιόρθωσης του DNA:

Η κάτω δεξιά εικόνα, 2G, δείχνει πώς η παρουσία της πρωτεΐνης ακίδας αναστέλλει την επιδιόρθωση του DNA μετά από διάφορες προσβολές στο DNA, όπως ακτινοβολία, έκθεση σε χημικά ή οξείδωση. Είναι σημαντικό, όπως εξηγούν οι συγγραφείς της μελέτης:

Μετά από διαφορετικές θεραπείες βλάβης του DNA, όπως η ακτινοβόληση β, η θεραπεία με δοξορουβικίνη και η θεραπεία με H2O2, υπάρχει λιγότερη επιδιόρθωση λόγω της παρουσίας της πρωτεΐνης ακίδας (Εικόνα 2F, G). Μαζί, αυτά τα δεδομένα δείχνουν ότι η πρωτεΐνη ακίδας επηρεάζει άμεσα την επιδιόρθωση του DNA στον πυρήνα.

ΠΗΓΗ:https://www.pronews.gr/ygeia/farmaka/1031056_emvolia-kata-covid-19-oi-proteines-akidas-prokaloyn-ton-olethro-ston-mihanismo

 

Οι πρωτεΐνες ακίδας τόσο του Covid-19 όσο και των 4 εμβολίων εμποδίζουν έως βλάπτουν τον μηχανισμό επιδιόρθωσης του DNA

Article

SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro

by

1,2,* and

2,*

1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umeå University, SE-90185 Umeå, Sweden
*
Authors to whom correspondence should be addressed.
Academic Editor: Oliver Schildgen
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021
(This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions)

Abstract (ΣΥΝΟΠΤΙΚΑ)

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.

1. Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.

2. Materials and Methods

2.1. Antibodies and Reagents

DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and β-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), γ–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).

2.2. Plasmids

pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5′–CACAGTGCTACAGACTGGAACAAAAACC–3′. 23–spacer RSS sequence: 5′–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3′. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].

2.3. Cells and Cell Culture

HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100 μg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.

2.4. HR and NHEJ Reporter Assays

HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 μg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.

2.5. Cellular Fractionation and Immunoblotting

For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 μm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).

2.6. Comet Assay

Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 μg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).

2.7. Immunofluorescence

Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.

2.8. Analysis of V(D)J Recombination

Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.

2.9. Statistical Analysis

All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.

3. Results

3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair

DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV–2 proteins affect the host cell DNA damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus (Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13, Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B). Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure 1B–E, Figures S2A,B and S3A,B).
Figure 1. Effect of severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) nuclear-localized proteins on DNA damage repair. (A) Subcellular distribution of the SARS–CoV–2 proteins. Immunofluorescence was performed at 24 h after transfection of the plasmid expressing the viral proteins into HEK293T cells. Scale bar: 10 µm. (B) Schematic of the EJ5-GFP reporter used to monitor non-homologous end joining (NHEJ). (C) Effect of empty vector (E.V) and SARS–CoV–2 proteins on NHEJ DNA repair. The values represent the mean ± standard deviation (SD) from three independent experiments (see representative FACS plots in Figure S2A). (D) Schematic of the DR-GFP reporter used to monitor homologous recombination (HR). (E) Effect of E.V and SARS–CoV–2 proteins on HR DNA repair. The values represent the mean ± SD from three independent experiments (see representative FACS plots in Figure S2B). The values represent the mean ± SD, n = 3. Statistical significance was determined using one-way analysis of variance (ANOVA) in (C,E). ** p < 0.01, *** p < 0.001, **** p <  0.0001.

3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair

Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies [20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination. Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the functional features required for DNA repair inhibition. Only the full–length spike protein strongly inhibited both NHEJ and HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA damage treatments, such as γ–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the nucleus.
Figure 2. Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein inhibits DNA damage repair. (A) Schematic of the primary structure of the SARS–CoV–2 spike protein. The S1 subunit includes an N–terminal domain (NTD, 14–305 residues) and a receptor–binding domain (RBD, 319–541 residues). The S2 subunit consists of the fusion peptide (FP, 788–806 residues), heptapeptide repeat sequence 1 (HR1, 912–984 residues), HR2 (1163–1213 residues), TM domain (TM, 1213–1237 residues), and cytoplasm domain (CT,1237–1273 residues). (B,C) Effect of titrated expression of the spike protein on DNA repair in HEK–293T cells. (D,E) Only full-length spike protein inhibits non-homologous end joining (NHEJ) and homologous recombination (HR) DNA repair. The values represent the mean ± SD from three independent experiments (see representative FACS plots in Figure S4A,B). (F) Full–length spike (S–FL) protein–transfected HEK293T cells exhibited more DNA damage than empty vector-, S1–, and S2–transfected cells under different DNA damage conditions. For doxorubicin: 4 µg/mL, 2 h. For γ–irradiation: 10 Gy, 30 min. For H2O2: 100 µM, 1 h. Scale bar: 50 µm. (G) Corresponding quantification of the comet tail moments from 20 different fields with n > 200 comets of three independent experiments. Statistical significance was assessed using a two-way analysis of variance (ANOVA). NS (Not Significant): * p > 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins

To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, γ–H2A.X, in spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression (Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.
Figure 3. Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein impedes the recruitment of DNA damage repair checkpoint proteins. (A) Membrane fraction (MF), cytosolic fraction (CF), soluble nuclear fraction (SNF), and chromatin-bound fraction (CBF) from HEK293T cells transfected with SARS–CoV–2 spike protein were immunoblotted for His-tag spike and indicated proteins. (B) Left: Immunoblots of DNA damage marker γH2AX in empty vector (E.V)– and spike protein–expressing HEK293T cells after 10 Gy γ-irradiation. Right: corresponding quantification of immunoblots in left. The values represent the mean ± SD (n = 3). Statistical significance was determined using Student’s t-test. **** p < 0.0001. (C) Immunoblots of DNA damage repair related proteins in spike protein–expressing HEK293T cells. (D) Representative images of 53BP1 foci formation in E.V– and spike protein-expressing HEK293 cells exposed to 10 Gy γ–irradiation. Scale bar: 10 µm. (E) Quantitative analysis of 53BP1 foci per nucleus. The values represent the mean ± SEM, n = 50. (F) BRCA1 foci formation in empty vector- and spike protein-expressing HEK293 cells exposed to 10 Gy γ–irradiation. Scale bar: 10 µm. (G). Quantitative analysis of BRCA1 foci per nucleus. The values represent the mean ± SEM, n = 50. Statistical significance was determined using Student’s t-test. **** p < 0.0001.

3.4. Spike Protein Impairs V(D)J Recombination In vitro

DNA damage repair, especially NHEJ repair, is essential for V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines, such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein [25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).
Figure 4. Spike protein impairs V(D)J recombination in vitro. (A) Schematic of the V(D)J reporter system. (B) Representative plots of flow cytometry show that the SARS–CoV–2 spike protein impedes V(D)J recombination in vitro. (C) Quantitative analysis of relative V(D)J recombination. The values represent the mean ± SD, n = 3. Statistical significance was determined using Student’s t-test. **** p < 0.0001.

4. Discussion

Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination. Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV–2 spike proteins can weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that full–length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent study that a full–length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This suggests that the use of antigenic epitopes of the spike as a SARS–CoV–2 vaccine might be safer and more efficacious than the full–length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2 suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies for designing more efficient and safer vaccines.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and HR–DNA repair pathway, Figure S3: Nsp1, Nsp5, Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR– DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.

Author Contributions

H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-F.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Umeå University, Medical Faculty’s Planning grants for COVID–19 (research project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umeå University (grants: LP 17–2153, AMP 19–982, and LP 20–2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).

Institutional Review Board Statement

Not applicable, because of this study not involving humans or animals.

Informed Consent Statement

Not applicable, because of this study not involving humans.

Data Availability Statement

The data presented in this study are available in the main text and Supplementary Materials.

Conflicts of Interest

The authors have declared that no competing interests exist. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  1. V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
  2. Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D. Dysregulation of Cell Signaling by SARS-CoV-2. Trends Microbiol. 2021, 29, 224–237. [Google Scholar] [CrossRef]
  3. Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang, W.; et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin. Infect. Dis. 2020, 71, 762–768. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.; Ma, Z.; Mo, P.; Zhang, Y. Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020, 221, 1762–1769. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183–188. [Google Scholar] [CrossRef] [PubMed]
  6. Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.; Liao, P.; Qiu, J.F.; Lin, Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 2020, 26, 845–848. [Google Scholar] [CrossRef]
  7. Bednarski, J.J.; Sleckman, B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv. Immunol. 2012, 116, 175–204. [Google Scholar] [PubMed]
  8. Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of non-homologous end joining in V(D)J recombination. Immunol. Res. 2012, 54, 233–246. [Google Scholar] [CrossRef]
  9. Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol. 2019, 19, 231–242. [Google Scholar] [CrossRef]
  10. Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J recombination. Cell. Cycle 2011, 10, 1928–1935. [Google Scholar] [CrossRef]
  11. Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.; Mahowald, G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig, M.C.; et al. 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature 2008, 456, 529–533. [Google Scholar] [CrossRef] [PubMed]
  12. Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649. [Google Scholar] [CrossRef]
  13. Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus infection induces DNA replication stress partly through interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011, 286, 39546–39559. [Google Scholar] [CrossRef] [PubMed]
  14. Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar] [CrossRef] [PubMed]
  15. Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001, 15, 3237–3242. [Google Scholar] [CrossRef]
  16. Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008, 4, e1000110. [Google Scholar] [CrossRef]
  17. Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression and V(D)J recombination activity of mutated RAG-1 proteins. Nucleic Acids Res. 1993, 21, 5644–5650. [Google Scholar] [CrossRef]
  18. Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.; Demengeot, J.; Sarmento, L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front. Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
  19. Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q. A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020, 5, 269. [Google Scholar] [CrossRef]
  20. Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
  21. Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
  22. Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
  23. Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
  24. Hsu, A.C.-Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.; Hansbro, P.M.; Horvat, J.C.; Wang, F.; et al. SARS-CoV-2 Spike protein promotes hyper-inflammatory response that can be ameliorated by Spike-antagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro. bioRxiv 2020, 2020, 317818. [Google Scholar]
  25. Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and applications to phase 3 vaccine candidates. Lancet 2020, 396, 1595–1606. [Google Scholar] [CrossRef]
  26. Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel, T.L.; Monterio, L.B.; de Moraes, D.; Ferrari, A.J.R.; de Souza, G.F.; Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv 2020, 2020, 20200329. [Google Scholar]
  27. Borsa, M.; Mazet, J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020, 20, 592. [Google Scholar] [CrossRef]
  28. Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.; Ghirimoldi, M.; De Giorgis, V.; Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021, 8, 632290. [Google Scholar] [CrossRef]
  29. Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19 patients carry tenascin-C and fibrinogen-β in triggering inflammatory signals in distant organ cells. bioRxiv 2021, 2021, 430369. [Google Scholar]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source:https://www.mdpi.com/1999-4915/13/10/2056/htm

Χωρίς τα περίπου χάνουμε την αίσθηση της πραγματικότητας τυλιγμένοι στην ομίχλη του ΕΓΩ μας.

Καλημέρα !! και Καλή ΚΥΡΙΑΚΗ !!!
Έχει μεγάλο Περίσσευμα η Καρδιά μου σήμερα….και…. το μοιράζομαι ! ☀💗💞

image.jpeg

.❤☀💗☀
Στο τέλος της Θείας Λειτουργίας ο ιερέας έβγαλε ένα μικρό λόγο, να μας δώσει να καταλάβουμε το νόημα της σημερινής ευαγγελικής περικοπής… του φτωχού Λαζάρου και του πλουσίου.
Ούτε ένα “περίπου” δεν άκουσα να βγαίνει από το στόμα του
Ούτε ένα ‘περίπου”…για να κρυφτώ…κάπου
ένα “περίπου”  για να τυλιχθώ
ούτε ένα “περίπου”…για να αναρωτιέμαι….. τι ήθελε να πει ο Ποιητής
ούτε ένα “περίπου”….να το ανακατέψω με ένα ψίχουλο βολής….και αναβολής
Ούτε ένα “ΠΕΡΙΠΟΥ”…..
.και αφού …ούτε μια “Κρυψώνα” δεν βρήκα…..να κρυφτώ…..
να κρύψω  σκέψεις , προθέσεις ..και νοήματα…
να στριμώξω κανα “περίπου” μου
Τρέχω  …. Ελεύθερη … στο Φως !!!! ☀

ΥΓ . όταν σας κλέβουν..💗  τα “Περίπου”….Ξημερώνει  ….Κυριακή  !!!!

εικόνα.png

εικόνα.png

Η πολύ καλή φίλη και συναγωνίστρια απέναντι στο παγκόσμιο έγκλημα των τσιμπημάτων… Χριστίνα Σαγιά

Βιαστικές, αντιεπιστημονικές και παραποιημένες οι μέθοδοι δοκιμής των εμβολίων της Pfizer καταλήγει το British Medical Journal. Και τι μ’ αυτό; Αδίστακτοι το φόρτωσαν στη πλάτη των πολιτών

Covid-19: Researcher blows the whistle on data integrity issues in Pfizer’s vaccine trial

BMJ 2021; 375 doi: https://doi.org/10.1136/bmj.n2635 (Published 02 November 2021) Cite this as: BMJ 2021;375:n2635

Read our latest coverage of the coronavirus pandemic

Δισεκατομμύρια έχει πληρώσει σε πρόστιμα η Pfizer για τις φαρμακευτικές της εγκληματικές ενέργειες αλλά τα δις των κερδών της είναι άπειρα…

  1. Paul D Thacker, investigative journalist

Author affiliations

Revelations of poor practices at a contract research company helping to carry out Pfizer’s pivotal covid-19 vaccine trial raise questions about data integrity and regulatory oversight. Paul D Thacker reports

In autumn 2020 Pfizer’s chairman and chief executive, Albert Bourla, released an open letter to the billions of people around the world who were investing their hopes in a safe and effective covid-19 vaccine to end the pandemic. “As I’ve said before, we are operating at the speed of science,” Bourla wrote, explaining to the public when they could expect a Pfizer vaccine to be authorised in the United States.1

But, for researchers who were testing Pfizer’s vaccine at several sites in Texas during that autumn, speed may have come at the cost of data integrity and patient safety. A regional director who was employed at the research organisation Ventavia Research Group has told The BMJ that the company falsified data, unblinded patients, employed inadequately trained vaccinators, and was slow to follow up on adverse events reported in Pfizer’s pivotal phase III trial. Staff who conducted quality control checks were overwhelmed by the volume of problems they were finding. After repeatedly notifying Ventavia of these problems, the regional director, Brook Jackson, emailed a complaint to the US Food and Drug Administration (FDA). Ventavia fired her later the same day. Jackson has provided The BMJ with dozens of internal company documents, photos, audio recordings, and emails.

Poor laboratory management

On its website Ventavia calls itself the largest privately owned clinical research company in Texas and lists many awards it has won for its contract work.2 But Jackson has told The BMJ that, during the two weeks she was employed at Ventavia in September 2020, she repeatedly informed her superiors of poor laboratory management, patient safety concerns, and data integrity issues. Jackson was a trained clinical trial auditor who previously held a director of operations position and came to Ventavia with more than 15 years’ experience in clinical research coordination and management. Exasperated that Ventavia was not dealing with the problems, Jackson documented several matters late one night, taking photos on her mobile phone. One photo, provided to The BMJ, showed needles discarded in a plastic biohazard bag instead of a sharps container box. Another showed vaccine packaging materials with trial participants’ identification numbers written on them left out in the open, potentially unblinding participants. Ventavia executives later questioned Jackson for taking the photos.

Early and inadvertent unblinding may have occurred on a far wider scale. According to the trial’s design, unblinded staff were responsible for preparing and administering the study drug (Pfizer’s vaccine or a placebo). This was to be done to preserve the blinding of trial participants and all other site staff, including the principal investigator. However, at Ventavia, Jackson told The BMJ that drug assignment confirmation printouts were being left in participants’ charts, accessible to blinded personnel. As a corrective action taken in September, two months into trial recruitment and with around 1000 participants already enrolled, quality assurance checklists were updated with instructions for staff to remove drug assignments from charts.

In a recording of a meeting in late September2020 between Jackson and two directors a Ventavia executive can be heard explaining that the company wasn’t able to quantify the types and number of errors they were finding when examining the trial paperwork for quality control. “In my mind, it’s something new every day,” a Ventavia executive says. “We know that it’s significant.”

Ventavia was not keeping up with data entry queries, shows an email sent by ICON, the contract research organisation with which Pfizer partnered on the trial. ICON reminded Ventavia in a September 2020 email: “The expectation for this study is that all queries are addressed within 24hrs.” ICON then highlighted over 100 outstanding queries older than three days in yellow. Examples included two individuals for which “Subject has reported with Severe symptoms/reactions … Per protocol, subjects experiencing Grade 3 local reactions should be contacted. Please confirm if an UNPLANNED CONTACT was made and update the corresponding form as appropriate.” According to the trial protocol a telephone contact should have occurred “to ascertain further details and determine whether a site visit is clinically indicated.”

Worries over FDA inspection

Documents show that problems had been going on for weeks. In a list of “action items” circulated among Ventavia leaders in early August 2020, shortly after the trial began and before Jackson’s hiring, a Ventavia executive identified three site staff members with whom to “Go over e-diary issue/falsifying data, etc.” One of them was “verbally counseled for changing data and not noting late entry,” a note indicates.

At several points during the late September meeting Jackson and the Ventavia executives discussed the possibility of the FDA showing up for an inspection (box 1). “We’re going to get some kind of letter of information at least, when the FDA gets here . . . know it,” an executive stated.

Box 1

A history of lax oversight

When it comes to the FDA and clinical trials, Elizabeth Woeckner, president of Citizens for Responsible Care and Research Incorporated (CIRCARE),3 says the agency’s oversight capacity is severely under-resourced. If the FDA receives a complaint about a clinical trial, she says the agency rarely has the staff available to show up and inspect. And sometimes oversight occurs too late.

In one example CIRCARE and the US consumer advocacy organisation Public Citizen, along with dozens of public health experts, filed a detailed complaint in July 2018 with the FDA about a clinical trial that failed to comply with regulations for the protection of human participants.4 Nine months later, in April 2019, an FDA investigator inspected the clinical site. In May this year the FDA sent the triallist a warning letter that substantiated many of the claims in the complaints. It said, “[I]t appears that you did not adhere to the applicable statutory requirements and FDA regulations governing the conduct of clinical investigations and the protection of human subjects.”5

“There’s just a complete lack of oversight of contract research organisations and independent clinical research facilities,” says Jill Fisher, professor of social medicine at the University of North Carolina School of Medicine and author of Medical Research for Hire: The Political Economy of Pharmaceutical Clinical Trials.

Ventavia and the FDA

A former Ventavia employee told The BMJ that the company was nervous and expecting a federal audit of its Pfizer vaccine trial.

“People working in clinical research are terrified of FDA audits,” Jill Fisher told The BMJ, but added that the agency rarely does anything other than inspect paperwork, usually months after a trial has ended. “I don’t know why they’re so afraid of them,” she said. But she said she was surprised that the agency failed to inspect Ventavia after an employee had filed a complaint. “You would think if there’s a specific and credible complaint that they would have to investigate that,” Fisher said.

In 2007 the Department of Health and Human Services’ Office of the Inspector General released a report on FDA’s oversight of clinical trials conducted between 2000 and 2005. The report found that the FDA inspected only 1% of clinical trial sites.6 Inspections carried out by the FDA’s vaccines and biologics branch have been decreasing in recent years, with just 50 conducted in the 2020 fiscal year.7

RETURN TO TEXT

The next morning, 25 September 2020, Jackson called the FDA to warn about unsound practices in Pfizer’s clinical trial at Ventavia. She then reported her concerns in an email to the agency. In the afternoon Ventavia fired Jackson—deemed “not a good fit,” according to her separation letter.

Jackson told The BMJ it was the first time she had been fired in her 20 year career in research.

Concerns raised

In her 25 September email to the FDA Jackson wrote that Ventavia had enrolled more than 1000 participants at three sites. The full trial (registered under NCT04368728) enrolled around 44 000 participants across 153 sites that included numerous commercial companies and academic centres. She then listed a dozen concerns she had witnessed, including:

  • Participants placed in a hallway after injection and not being monitored by clinical staff

  • Lack of timely follow-up of patients who experienced adverse events

  • Protocol deviations not being reported

  • Vaccines not being stored at proper temperatures

  • Mislabelled laboratory specimens, and

  • Targeting of Ventavia staff for reporting these types of problems.

Within hours Jackson received an email from the FDA thanking her for her concerns and notifying her that the FDA could not comment on any investigation that might result. A few days later Jackson received a call from an FDA inspector to discuss her report but was told that no further information could be provided. She heard nothing further in relation to her report.

In Pfizer’s briefing document submitted to an FDA advisory committee meeting held on 10 December 2020 to discuss Pfizer’s application for emergency use authorisation of its covid-19 vaccine, the company made no mention of problems at the Ventavia site. The next day the FDA issued the authorisation of the vaccine.8

In August this year, after the full approval of Pfizer’s vaccine, the FDA published a summary of its inspections of the company’s pivotal trial. Nine of the trial’s 153 sites were inspected. Ventavia’s sites were not listed among the nine, and no inspections of sites where adults were recruited took place in the eight months after the December 2020 emergency authorisation. The FDA’s inspection officer noted: “The data integrity and verification portion of the BIMO [bioresearch monitoring] inspections were limited because the study was ongoing, and the data required for verification and comparison were not yet available to the IND [investigational new drug].”

Other employees’ accounts

In recent months Jackson has reconnected with several former Ventavia employees who all left or were fired from the company. One of them was one of the officials who had taken part in the late September meeting. In a text message sent in June the former official apologised, saying that “everything that you complained about was spot on.”

Two former Ventavia employees spoke to The BMJ anonymously for fear of reprisal and loss of job prospects in the tightly knit research community. Both confirmed broad aspects of Jackson’s complaint. One said that she had worked on over four dozen clinical trials in her career, including many large trials, but had never experienced such a “helter skelter” work environment as with Ventavia on Pfizer’s trial.

“I’ve never had to do what they were asking me to do, ever,” she told The BMJ. “It just seemed like something a little different from normal—the things that were allowed and expected.”

She added that during her time at Ventavia the company expected a federal audit but that this never came.

After Jackson left the company problems persisted at Ventavia, this employee said. In several cases Ventavia lacked enough employees to swab all trial participants who reported covid-like symptoms, to test for infection. Laboratory confirmed symptomatic covid-19 was the trial’s primary endpoint, the employee noted. (An FDA review memorandum released in August this year states that across the full trial swabs were not taken from 477 people with suspected cases of symptomatic covid-19.)

“I don’t think it was good clean data,” the employee said of the data Ventavia generated for the Pfizer trial. “It’s a crazy mess.”

A second employee also described an environment at Ventavia unlike any she had experienced in her 20 years doing research. She told The BMJ that, shortly after Ventavia fired Jackson, Pfizer was notified of problems at Ventavia with the vaccine trial and that an audit took place.

Since Jackson reported problems with Ventavia to the FDA in September 2020, Pfizer has hired Ventavia as a research subcontractor on four other vaccine clinical trials (covid-19 vaccine in children and young adults, pregnant women, and a booster dose, as well an RSV vaccine trial; NCT04816643, NCT04754594, NCT04955626, NCT05035212). The advisory committee for the Centers for Disease Control and Prevention is set to discuss the covid-19 paediatric vaccine trial on 2 November.

Footnotes

  • Provenance and peer review: commissioned; externally peer reviewed.

  • Competing interests: PDT has been doubly vaccinated with Pfizer’s vaccine.

This article is made freely available for use in accordance with BMJ’s website terms and conditions for the duration of the covid-19 pandemic or until otherwise determined by BMJ. You may use, download and print the article for any lawful, non-commercial purpose (including text and data mining) provided that all copyright notices and trade marks are retained.

https://bmj.com/coronavirus/usage

References