Ο πρώην συνταγματάρχης και αμυντικός εμπειρογνώμωνας του Ερυθρού Στρατού Khodarenok, απάντησε: «Αυτή είναι μια αυστηρά προσωπική μου κρίση. Πιστεύω ότι κάθε αντιπαράθεση μπορεί να σταματήσει, άπαξ και απειλήσουμε με την ανάπτυξη τουλάχιστον τακτικών πυρηνικών όπλων. Οποιαδήποτε σύγκρουση θα σταματήσει σε αυτήν την περίπτωση».
Δυτικά ΜΜΕ σχολιάζουν πως «ηγετικές μορφές της Ρωσίας συμβουλεύουν τον Πούτιν να σκεφθεί τα πυρηνικά όπλα».
Ο Solovyev ρωτά ξανά τον Khodarenok: «Δηλαδή η όποια (προειδοποιητική;) έκρηξη πρέπει να γίνει σε ουδέτερο έδαφος;».
«Θα πρέπει να είναι μία εκτόξευση επίδειξης (δύναμης) σε ερημωμένο μέρος του παγκόσμιου ωκεανού. Αλλά όχι και τόσο ερημωμένο, ώστε η εκτόξευση να μην είναι ορατή», απάντησε ο πρώην στρατιωτικός, θέλοντας να δείξει πως η Δύση πρέπει να λάβει σοβαρά υπόψη τον κίνδυνο που την περιμένει.
A pharmacy technician prepares a dose of the Pfizer-BioNTech COVID-19 vaccine during a mass vaccination event in the parking lot of Coors Field in Denver, Colo., on Feb. 20, 2021. (Michael Ciaglo/Getty Images)
The Centers for Disease Control and Prevention (CDC) told The Epoch Times in an email that as of March 8, over 92 million doses of mRNA vaccines for COVID-19 have been injected, with 1,637 deaths occurring following the injections. The CDC claims the vaccines are safe, but a comparison between the rates of deaths following the vaccines for COVID and those for influenza raises questions.
The Epoch Times hasn’t been able independently to confirm the CDC’s numbers. The publicly available Vaccine Adverse Events Reporting System (VAERS) website shows 1136 deaths through Feb. 26. Details of these deaths are in a spreadsheet linked at the bottom of this article: symptoms before death, age, gender, time between injection and death, and so forth.
Between Dec. 14 and Feb. 26, 25,072 reports were made to the VAERS system of immunizations with either the Moderna or Pfizer BioNTech mRNA vaccines (the only two vaccines given during the time period assessed).
The 1136 deaths represent 4.5 percent of the total number of adverse events reports. Of those who died, 94, or 8.3 percent, died on the same day they got the shot. An additional 150 (13.2 percent) died the day after. Another 105 died two days after, and 68 died three days after.
A total of 587 (51.7 percent) died within a week, 215 died within 7 to 13 days, and 124 within 14 to 20 days.
85.8 percent of deaths occurred in people over 60. There were five deaths among those aged 20–29; 10 in those aged 30–39; 23 in those aged 40–49; and 69 aged 50–59.
Information drawn from VAERS reports on mRNA vaccinations for COVID-19. (source: CDC)
Comparison With Influenza Vaccines
Neither of the mRNA vaccines is FDA approved, rather, they have Emergency Use Approval (EUA).They represent a departure from traditional vaccines in that they do not use any part of the suspected pathogen to stimulate the immune system, but rather, nucleoside messenger RNA.
Dr. Christian Perrone, head of infectious disease at the Hôpital de Garches in France, stated in a complaint filed in Europe:
“The first vaccines they are offering us are not vaccines. They are gene therapy products. (Γενετικά τροποποιημένα παράγωγα προοριζομενα για θεραπεία).They…inject nucleic acids that will cause our own cells to produce elements of the virus.”
The death rate following COVID mRNA vaccination is much higher than that following influenza vaccination.
The CDC’s data allows only a ballpark estimation of the rate of deaths following flu vaccination.
In the 2019-2020 influenza season the CDC reports that 51.8 percent of the U.S. population received a vaccine, which is approximately 170 million people.
VAERS reports that in the calendar year 2019 (not the 2019-2020 influenza season) there were 45 deaths following vaccination. To provide context, in 2018 VAERS reports 46 deaths, and in 2017 it reports 20 deaths.
The 45 deaths in 2019 are occurring at a rate of 0.0000265 percent when calculated using the number of vaccines given in the 2019–2020 influenza season.
As of Feb. 26, 47,184,199 COVID vaccinations had been given with 1136 deaths reported following vaccination, which is approximately a rate of .0024 percent
The 1,637 deaths reported by the CDC following 92 million vaccinations are occurring at an approximate rate of .0018 percent.
Because the mRNA vaccines each require two shots, the number of vaccinations given does not equate to the number of people vaccinated. If the 92 million vaccinations, for instance, represented each person receiving both shots, then there would be 46 million people who had been vaccinated. But it is impossible to say exactly how many people have received one shot or both shots.
The VAERS System
VAERS was put in place in 1990, to capture unforeseen reactions from vaccines.
The VAERS website describes the system in this way:
“Established in 1990, the Vaccine Adverse Event Reporting System (VAERS) is a national early warning system to detect possible safety problems in U.S.-licensed vaccines. VAERS is co-managed by the Centers for Disease Control and Prevention (CDC) and the U.S. Food and Drug Administration (FDA). VAERS accepts and analyzes reports of adverse events (possible side effects) after a person has received a vaccination. Anyone can report an adverse event to VAERS. Health care professionals are required to report certain adverse events and vaccine manufacturers are required to report all adverse events that come to their attention.
“VAERS is a passive reporting system, meaning it relies on individuals to send in reports of their experiences to CDC and FDA. VAERS is not designed to determine if a vaccine caused a health problem, but is especially useful for detecting unusual or unexpected patterns of adverse event reporting that might indicate a possible safety problem with a vaccine. This way, VAERS can provide CDC and FDA with valuable information that additional work and evaluation is necessary to further assess a possible safety concern.”
Deaths Reported on VAERS
On the web page “Selected Adverse Events Reported after COVID-19 Vaccination” dated March 1, the CDC states that “reports of death to VAERS following vaccination do not necessarily mean the vaccine caused the death.”
“[The] CDC follows up on any report of death to request additional information and learn more about what occurred and to determine whether the death was a result of the vaccine or unrelated,” the CDC states.
“To date, VAERS has not detected patterns in cause of death that would indicate a safety problem with COVID-19 vaccines.
“A review of available clinical information including death certificates, autopsy, and medical records revealed no evidence that vaccination contributed to patient deaths.” Comment:They died automatically by themeselves!!! But not because of the vaccine, even if they died the same day after they got the shot!!!
When asked whether the higher rate of death following COVID-19 vaccinations, compared to that for influenza, vaccines was a concern, the CDC stated in an email, “At this point in the national vaccination program, COVID-19 vaccines are being largely administered to the oldest adults in our population, those who are at high risk for hospitalization, illness and death from COVID-19 and those with underlying medical conditions which increase the risk of serious, life-threatening complications from COVID-19.”
The CDC also pointed out that, unlike other vaccines, all deaths associated with the COVID vaccines were required to be reported.
In a reply to The Epoch Times, about the VAERS death reports, Steven Danehy, director of Global Media Relations for Pfizer, wrote:
“To date, millions of people have been vaccinated with our vaccine. Serious adverse events, including deaths that are unrelated to the vaccine, are unfortunately likely to occur at a similar rate as they would in the general population.”
Moderna has not responded to requests for comment.
The VAERS database is dense with information and can be difficult for some users to follow. The Epoch Times has extracted its data as clearly as possible in charts provided in the link below.
At the link below are charts containing: on the tab “All Deaths Readable” descriptions of what happened to the patients—effects they experienced as reported by health care workers and/or relatives, or other witnesses; VAERS ID numbers (used to look up a complete file on the VAERS database); vaccination type; manufacturer; vaccination name; date received; age, gender and state of each recipient; as well as medical history; and other medications patients were taking.
UPDATE: Using information variously published by the CDC on March 1, provided to The Epoch Times in a March 9 email, and obtained by an analysis of the latest publicly available VAERS data, this article was updated on March 9. It was previously published under the headline “Adverse Incident Reports Show 966 Deaths Following Vaccination for COVID-19.”
“Υπάρχει σκοπούμενος δόλος και απάτη πίσω από το covidbusiness”.
Λέει ο στρατιωτικός Ιατρός πρώην Επιμελητής Καρδιολογικής Κλινικής 251 Γ.Ν.Αεροπορίας, Γιώργος Καρυστινός*
Με το θέμα του covid έχει γίνει το εξής: Η συγκεκριμένη ομάδα ιών τύπου corona (ΔΕΝ είναι 1 ιός, αλλά ομάδα, κάτι σαν να λέμε αιλουροειδή) υπάρχουν στη γη εδώ και εκατομμύρια χρόνια και προκαλούν λοιμώξεις αναπνευστικού. Κάθε χρόνο μεταλλάσσονται, αφού τα προηγούμενα στελέχη έχουν ήδη προκαλέσει την παραγωγή αντισωμάτων σε πάρα πολύ μεγάλο ποσοστό πληθυσμού κι αν δεν μεταλλαχθούν ώστε να μπορούν να ξαναπροσβάλλουν, απλά θα εξαφανιστούν από τη γη γιατί ο γενικός πληθυσμός που έχει αναπτύξει αντισώματα δεν μπορεί να ξαναπροσβληθεί, ώστε να αναπαραχθεί ο ιός (δηλ πρακτικά η ετήσια μετάλλαξή τους είναι μέθοδος επιβίωσής τους).
Οι ιοί προσβάλλουν μόνο ένα είδος κυττάρων ο καθένας, όχι πολλά είδη κυττάρων, έχουν δηλαδή “εξειδίκευση”.
Όταν εισβάλλουν, ρίχνουν το ανοσοποιητικό (ειδικά τα λευκά αιμοσφαίρια), όπως ξέρουμε από φοιτητές (θα θυμάσαι ότι αν σε γενική αίματος είναι λίγο χαμηλά τα λευκά, ο ιατρός ρωτάει: μήπως πέρασες γρίπη τελευταία?).
Προκαλούν όμως ήπια ως πιο-μέτρια συμπτώματα. Όμως το ότι ρίχνουν το ανοσοποιητικό (λευκά), δίνει συχνά την ευκαιρία σε μικρόβια (εδώ: συχνότερα στο μυκόπλασμα) να εισβάλλουν και να προκαλέσουν μικροβιακή πνευμονία (το μυκόπλασμα προκαλεί την λεγόμενη άτυπη πνευμονία). Η κομπίνα που έχει στηθεί είναι ότι τα χαρακτηριστικά της επιλοίμωξης με μικρόβια και ειδικά από μυκόπλασμα τα πλασσάρουν ότι δήθεν είναι του ιού ενώ ΔΕΝ είναι του ιού, αλλά των μικροβιακών επιλοιμώξεων (με πιο χαρακτηριστικές αυτές από μυκοπλάσμα)!
Τα μικρόβια μπορούν να προσβάλλουν πολλά όργανα, όχι οι ιοί! Ομοίως και να προκαλέσουν αιμορραγικά ή θρομβωτικά φαινόμενα, έκκριση κυτοκίνης κλπ, απότοκα υπερβολικής γενικευμένης αντίδρασης του ανοσοποιητικού (ενδεχομένως λόγω και “πανικού” του ανοσοποιητικού, αφού ενστικτωδώς το σώμα αντιλαμβάνεται ότι έχει προσβληθεί από πολύ ισχυρότερο λοιμογόνο αίτιο σε σχέση με τον ιό).
Τα μικρόβια όμως, χτυπιούνται με αντιβιοτικά. Πλασσάροντας ότι δήθεν τα συμπτώματα επιλοίμωξης (με ξαφνική επιδείνωση κλινικής εικόνας με δύσπνοια-πτώση κορεσμού) είναι του ιού, ΑΠΟΤΡΕΠΟΥΝ τον κόσμο να πάρει αντιβιοτικά, με αποτέλεσμα τα μικρόβια και ειδικά το μυκόπλασμα που είναι πολύ επιθετικό, να αφήνονται ανεξέλεγκτα να δρουν! Κάπως έτσι καταλήγουν οι ασθενείς σε διασωληνώσεις η/και θανάτους!
Τι πρέπει να γίνει, είναι πολύ απλό:
Αντιβιοτικά με ΕΝΑΡΞΗ συμπτωμάτων:
Co-amoxiclav (Augmentin) 1gr ανά 12ωρο για 7-8 μέρες ΚΑΙ Azithromycin (Zithromax) 500mg 1 φορά τη μέρα για 5-7 μέρες (λαμβάνονται και τα δύο αντιβιοτικά ταυτόχρονα).
Επί αλλεργίας στο Augmentin, δίδεται clarithromycin (Claricid) 500 mg ανά 12ωρο για 5-7 μέρες.
Επί επιδείνωσης με δύσπνοια-πτώση κορεσμού: stop τα ανωτέρω και έναρξη moxifloxacin (avelox) 400mg 1 φορά ημερησίως για 5-7 μέρες (πολύ πιο αποτελεσματικό).
Υπ’ όψιν ότι η υδροξυχλωροκίνη που “διαφημίστηκε”, εκτός ότι έχει σοβαρές παρενέργειες (περαιτέρω μείωση λευκών αιμοσφαιρίων και πρόκληση παράτασης διαστήματος QT στο καρδιογράφημα-προκαλεί κοιλιακές ταχυκαρδίες που συχνά είναι θανατηφόρες) και δεν προσφέρει τίποτα, αν ληφθεί απαγορεύεται ο ασθενής να πάρει avelox (το πολύ δραστικό αντιβιοτικό)! Πρέπει να διακοπεί η υδροξυχλωροκίνη για 2-3 μέρες και μετά μπορεί να δοθεί avelox (που θα είναι πολύ αργά, αφού τα μικρόβια και ειδικά το μυκόπλασμα, θα αφεθούν να δρουν ανεξέλεγκτα αυτές τις επιπλέον 2-3 μέρες, με καταστροφικές συνέπειες).
Βοηθητική επίσης των συμπτωμάτων επί μικροβιακής επιλοίμωξης είναι και η χορήγηση κορτιζόνης.
Υπ’ όψιν ότι δεν χρειάζεται νοσηλεία, υπό την προϋπόθεση ότι τα αντιβιοτικά θα ξεκινήσουν ΕΓΚΑΙΡΑ και όχι καθυστερημένα! Γι’ αυτό από 1/9/20 αυστηροποίησαν τη συνταγογράφησή τους με κριτήρια (ακτινογραφία θώρακος+ εξετάσεις αίματος+καλλιέργειες αίματος), που για να πληρούνται, ο ασθενής πρέπει να πάει νοσοκομείο να τα κάνει ή σε μεγάλο διαγνωστικό κέντρο, όπου όμως λόγω συμπτωμάτων ΔΕΝ θα του τα κάνουν, γιατί θα του πουν να πάει σπίτι του και να μείνει εκεί βάσει (αθλίων) οδηγιών του ΕΟΔΥ και να έρθει μόνο όταν εμφανίσει δύσπνοια (δηλ. όταν πλέον θα έχει καταρρεύσει το αναπνευστικό από μικροβιακή επιλοίμωξη!).
Κάπως έτσι “πέτυχαν” την αύξηση των σοβαρώς επιδεινούμενων ασθενών αυτό το Φθινόπωρο-Χειμώνα. Κατά τη γνώμη μου πρόκειται για ένα ακόμα έγκλημά τους (στα τόσα που έχουν διαπράξει ήδη).
Ελπίζω να βοήθησα να ξεκαθαρίσει το τοπίο”.
Σ.γ.: Υπόψιν ότι σπάνια το Plaquenil προκαλεί παράταση του QT κι ακόμη πιο σπάνια κοιλιακές ταχυκαρδίες. Όσον αφορά τη δράση του στον Covid-19 έχουμε αναρτήσει προσωπικές αφηγήσεις ιατρών και δη μιας μαύρης συναδέλφου στις ΗΠΑ η οποία ανέφερε ότι έχει θεραπεύσει πέραν των 300 ασθενών με το Plaquenil με θαυμαστά αποτελέσματα. Υπόψιν ότι η θειική υδροχλωρική κινίνη δηλ. το Plaquenil των 200mg δίνεται σε εκατοντάδες ασθενείς πάσχοντες από ρευματοειδή αρθρίτιδα (αυτοάνοσο νόσημα) και σπάνια αναφέρονται παρενέργειες από τα μάτια ή του καρδιακού ρυθμού κ.λπ. Είναι δε μια πιο επεξεργασμένη χημικά μορφή του φυτού κιγχόνα από όπου παράγεται η κινίνη, πανάρχαιο βότανο των Ίνκας και των Μάγιας ως ανθελονοσιακό, αναλγητικό κ.λπ. Για να μειώσει επίσης τα λευκά αιμοσφαίρια απαιτείται πολύς χρόνος.
Συμμετέχουν Πλήθος Επιστημόνων, μεταξύ των Οποίων και οι Didier Raoult, Christian Perronne, και Michael Holick
ΕΝΗΜΕΡΩΘΕΙΤΕ ΚΑΙ ΔΙΑΔΩΣΤΕ.
Σε λίγο καιρό, η λογοκρισία θα απλωθεί και στα ιστολόγια, όπως έχει απλωθεί και στα άλλα μέσα κοινωνικής δικτύωσης.
Όσο περισσότερο ενημερωμένοι είστε, τόσο περισσότερο θα γίνεστε και αποφασισμένοι να διεκδικήσετε την ΕΛΕΥΘΕΡΙΑ ΣΑΣ ΚΑΙ ΤΙΣ ΖΩΕΣ ΣΑΣ.
Καλλιόπη Σουφλή
Παγκόσμια απάτη ένας κοινός ιός από τους τόσους κορωνοϊούς απλώς με μεγαλύτερη (επίτηδες εργαστηριακά επεξεργασμένη) μεταδοτικότητα
Από της 07/12/20, ο κόσμος έχει ήδη δει αυτό το συγκλονιστικό ντοκιμαντέρ, πάνω από 500.000 φορές.
Αυτή η ταινία απέχει από τις θεωρίες συνωμοσιών. Στηρίζεται πάνω σε γεγονότα και σε εύλογα ερωτήματα.
Το ντοκιμαντέρ αποκαλύπτει τα παρασκήνια των γαλλικών δημόσιων αρχών, που απέρριψαν αποτελεσματικά πρωτόκολλα, για τη θεραπεία ασθενών του SARS-CoV-2, για οικονομικούς λόγους.
Εκθέτει τα ΜΜΕ, που με τον τρόπο τους, αποσιώπησαν η προώθησαν ορισμένες πληροφορίες.
Θα μάθετε επίσης το σημαντικό ρόλο του ψευδαργύρου, της βιταμίνης D, της βιταμίνης C και της ισορροπημένης διατροφής, για την πρόληψη και την θεραπεία κατά του Covid 19.
Ο σκηνοθέτης έχει συμπεριλάβει στο ντοκιμαντέρ του, ιατρούς, φαρμακοποιοούς και καθηγητές, όπως ο Didier Raoult, ο Christian Perronne, και ο Michael Holick.
Ένα βιολογικό όπλο πολυδιαφημισμένο από την Ελίτ των 10 να σας τρομοκρατήσει
Πρώην παρουσιαστής, ο Alexandre Chavouet είναι ο παραγωγός του ντοκιμαντέρ, που έχει ήδη την υποστήριξη του κοινωνιολόγου Laurent Mucchielli.
Θεματολογία της ταινίας:
00:00 – Τα παρασκήνια της μεταχείρισης των ασθενών του Covid 19.
38:17 – Ο ρόλος του ψευδαργύρου, της βιταμίνης D, της βιταμίνης C και της ισορροπημένης διατροφής.
Οι δύο αυτοί καταξιωμένοι πνευμονολόγοι έχουν πετύχει κάτι πολύ ενδιαφέρον… Η Ρουμάνα πνευμονολόγος κατάφερε με τις ιατρικές της γνώσεις να θεραπεύσει όλους τους ασθενείς της που έχουν ξεπεράσει τους 1000… Η ιατρική της ομάδα δεν είχε ούτε έναν θάνατο – Covid…!!! Τεράστιο είναι και το κατόρθωμα του πνευμονολόγου Λεωνίδα Στέλλα που κατάφερε να δώσει αρκετά εξιτήρια μέχρι και σε 85άχρονους… Το νοσοκομείο της Πάτρας όπου δραστηριοποιείται η ιατρική του ομάδα έχει ένα από τα χαμηλότερα ποσοστά θανάτων – Covid σ’ όλη την Ελλάδα… Και ίσως και στην Ευρώπη. Οι δύο αυτοί έμπειροι πνευμονολόγοι πέτυχαν τα θετικά αποτελέσματα τους αντιμετωπίζοντας τις πνευμονίες από Covid-19 όπως και τις υπόλοιπες που προέρχονται από ιογενή λοίμωξη…!!!
Πνευμονολόγος Flavian Grosan:
1) Eφαρμόζω το παραδοσιακό πρωτόκολλο για έναν ασθενή με πνευμονία από ιογενή λοίμωξη και όχι το πρωτόκολλο Covid-19 που “σκοτώνει” τους ασθενείς μέσα στα νοσοκομεία.
2) Χορηγώ φάρμακα όπως η Κλαριθρομυκίνη (Claricid)ενώ απαγορεύω την χορήγηση Kaleta και Κωδεΐνης.
3) Αποφεύγω την διασωλήνωση και όταν είναι απαραίτητο χορηγώ 2-3 λίτρα οξυγόνου ανά λεπτό και όχι 20 λίτρα υπό πίεση, που οδηγούν σε θάνατο.
Η διασωλήνωση, η χορήγηση οξυγόνου υπό πίεση άνω των 20 λίτρων, τα αντιικά της Καλέτρα και η κωδεΐνη ως αντιβηχικό, σκοτώνουν τους εισαγόμενους στις ΜΕΘ.
Για κάποιους γιατρούς η μάχη με τον κορωνοϊό μετατρέπεται σε προσωπική υπόθεση. Και είναι ακριβώς αυτή η παρήγορη αίσθηση που αποκομίζεις από την επαφή μαζί τους, ότι ο ιός που έχει αναστατώσει την ανθρωπότητα, έχει απέναντί του ένα πολύ γερό «αντίδοτο» φτιαγμένο από επιστημονική γνώση, έγνοια και ανθρωπιά.
Ο γνωστός πνευμονολόγος, διευθυντής της κλινικής covid του νοσοκομείου «Άγιος Ανδρέας» Λεωνίδας Στέλλας, είναι μια τέτοια περίπτωση.
Το ίδιο και οι άλλοι γιατροί της ομάδας η οποία δουλεύει σαν ένα καλοκουρδισμένο ρολόι επιτυγχάνοντας θεαματικά αποτελέσματα, γεγονός που καταδεικνύεται από τον αριθμό των εξιτηρίων αλλά και από το πολύ χαμηλό ποσοστό θανάτων ανθρώπων που πάσχουν από κορωνοϊό και περνούν την πόρτα του «Αγίου Ανδρέα»
Η ομάδα που συναποφασίζει
«Εμείς έχουμε κάνει κάτι πρωτοποριακό το οποίο νομίζω ότι το έχει κάνει και το «Σωτηρία». Έχουμε μια άμεση και διαρκή συνεργασία οι Πνευμονολόγοι με τους Παθολόγους και τους Εντατικολόγους» λέει στον «Ν» ο κ. Στέλλας.
«Πέρα από εμένα που είμαι πνευμονολόγος, η ομάδα αυτή αποτελείται από την Ντέμυ Δημητροπούλου που είναι λοιμωξιολόγος και τις εντατικολόγους Πατρούλα Μανωλοπούλου και Ιφιγένεια Ραβάνη. Κάθε πρωί συζητάμε τα περιστατικά covid και συναποφασίζουμε για το κάθε ένα ξεχωριστά.
Η άποψη η δική μας είναι ότι για τον κορωνοϊό δεν χρειαζόμαστε μονάδες, χρειαζόμαστε να κρατήσουμε τον κορωνοϊό πριν την μονάδα. Τι σημαίνει αυτό; Ότι χρειάζονται άνθρωποι οι οποίοι γνωρίζουν από εντατικολογία, κυρίως πνευμονολόγοι και εντατικολόγοι, για να μπορούν να χειριστούνε το μη μηχανικό αερισμό με υψηλή ροή οξυγόνου.
Μιλάμε για τα high flow μηχανήματα, τα οποία αποτρέπουν από τη διασωλήνωση των ασθενών. Αν δεν ξέρεις να χειριστείς αυτά τα μηχανήματα ή αν δεν έχεις το χρόνο όπως συμβαίνει π.χ στη Θεσσαλονίκη, αναγκάζεσαι να τους διασωληνώσεις. Θεωρώ ότι σχεδόν οι μισές διασωληνώσεις δεν θα έπρεπε να γίνουν.
Μελέτες έχουν δείξει ότι με το high flow μπορείς να καταφέρεις να διασωληνώσεις μόνο ένα 20% των ασθενών που χρειάζονται υψηλή ροή οξυγόνου.
Θα πρέπει να υπολογίσουμε ότι ο ιός αυτός θέλει χρόνο. Τα φάρμακα λειτουργούν πιο πολύ υποβοηθητικά, τον κρατάνε λίγο πιο πίσω, τον καθυστερούν για να έχει χρόνο να ανταπεξέλθει ο οργανισμός.
Όσο πιο πολύ κρατιέται λοιπόν ένας ασθενής, τόσο του δίνεται το περιθώριο ώστε σιγά σιγά να ανακάμψει» τονίζει ο κ. Στέλλας και εξηγεί:
«Εμείς λοιπόν στην ομάδα μας, το πετύχαμε αυτό. Να μην διασωληνώνουμε εύκολα τον κόσμο, γιατί απλούστατα συνεργαζόμαστε πολύ και καλά στο κομμάτι πριν τη διασωλήνωση.
Αυτό πέραν των στοιχίζει και πολύ λιγότερο. Θα έλεγα ότι στοιχίζει το ένα εικοστό μιας διασωλήνωσης. Η άποψή μας είναι ότι το κράτος όφειλε να στηρίξει τη νοσηλεία ΜΑΦ (Μονάδων Αυξημένης Φροντίδας) και όχι τόσο τις Μονάδες Εντατικής. Εκεί είναι που παίζεται το παιχνίδι».
«Δίνουμε εξιτήρια σε 85άρηδες»
Κάπως έτσι στο Νοσοκομείο «Άγιος Ανδρέας» κατάφεραν να διασωληνώσουν μέχρι τώρα ελάχιστους ασθενείς αλλά και να έχουν πολύ μικρά ποσοστά θνησιμότητας.
«Έχουμε δώσει εξιτήρια σε πάνω από τέσσερις 85άρηδες» λέει με χαρά ο κ. Στέλλας ο οποίος επίσης έχει κάθε λόγο να χαίρεται για τα τέσσερα επιπλέον εξιτήρια που έλαβαν την περασμένη Δευτέρα ηλικιωμένοι ασθενείς που νοσηλεύτηκαν επί πολλές ημέρες στην κλινική.
«Δουλεύουμε ομαδικά και έχουμε πάει πολύ καλά νομίζω μέχρι τώρα. Είναι σημαντική επίσης η βοήθεια που μας παρέχουν και ο Διοικητής της 6ης ΥΠΕ και ο Διοικητής του νοσοκομείου μας».
«Ο covid δεν είναι θανατηφόρα νόσος»
Δεν είναι μόνο οι ασθενείς που νοσηλεύονται μέσα στην κλινική του «Αγίου Ανδρέα». «Είναι και πάρα πολλοί ασθενείς έξω, που τους παρακολουθούμε. Έχω πάνω από 10 ασθενείς εκτός νοσοκομείου που παρακολουθώ και επικοινωνώ κάθε μέρα μαζί τους.
Πρόκειται κυρίως για θετικά κρούσματα στις ηλικίες 50-55 που τους παρακολουθούμε από το τηλέφωνο» λέει ο κ. Στέλλας ο οποίος επισημαίνει ότι αυτοί οι ασθενείς πάνε επίσης πολύ καλά και υπογραμμίζει:
«Ο covid δεν είναι μια θανατηφόρα νόσος. Είναι ένας ιός ο οποίος κάνει πνευμονία.
Και τώρα πια έχουμε και πολλά όπλα για να τον αντιμετωπίσουμε, όπως π.χ. το φάρμακο των μονοκλονικών αντισωμάτων που είχε χορηγηθεί στον Τραμπ και έρχεται και στην Ελλάδα.
Δεν θέλω να μιλάω λοιπόν για νεκρούς, αλλά για ανθρώπους που νοσούν και επιστρέφουν σπίτια τους. Διότι μιλάμε κάθε μέρα για τους νεκρούς, αλλά δεν μιλάμε και για τα εξιτήρια».
«Σαν να πηγαίνεις στο διάστημα»
Για τους γιατρούς των μονάδων covid η είσοδος σε αυτές είναι μια σωστή περιπέτεια. Λες και πας στο… διάστημα.
«Όταν πρέπει να μπεις μέσα σε ένα θάλαμο με τρεις στολές, φασκιωμένος στο πρόσωπο, ούτε βλέπεις καλά, ούτε ακούς καλά. Επίσης δεν μπορούμε να καθίσουμε υπ΄αυτές τις συνθήκες μέσα στο θάλαμο και να ασχοληθούμε μια ώρα με τον κάθε ασθενή. Πρέπει να μπαίνεις να κάθεσαι συνολικά μισή ώρα τρία τέταρτα και να βγαίνεις».
Ρωτήσαμε τον κ. Στέλλα αν το έχει πάρει προσωπικά το θέμα με τον covid.
«Bεβαίως και το παίρνω προσωπικά. Αν ήμουν 40 χρονών θα πήγαινα και στη Θεσσαλονίκη. Εγώ έβαλα τα 30 χρόνια εμπειρίας μου στην πνευμονολογία για να πάω να τα δώσω στον κορωνοιό. Γιατί το θεωρώ γελοίο να πεθαίνουμε από κορωνοϊό.
Γιατί να πεθάνει πρόωρα ένας άνθρωπος ακόμη και αν έχει πρόβλημα υγείας; Είναι μεγάλο το στοίχημα για μας. Φανταστείτε ότι πάω στο νοσοκομείο πρωί απόγευμα. Να δω τι γίνεται, πώς πάνε οι ασθενείς».
«Νιώθω πιο ασφαλής μέσα στην κλινική παρά έξω»
Φοβάται μην κολλήσει κορωνοϊό ο Λεωνίδας Στέλλας;
«Φοβάμαι πιο πολύ αυτόν που δεν ξέρει ότι έχει κορωνοϊό και κυκλοφορεί έξω παρά τους ασθενείς που νοσηλεύονται. Νιώθω πιο ασφαλής μέσα στην κλινική με τον κορωνοϊό παρά έξω, όπου χαλαρώνεις. Εκεί μπορεί να κολλήσεις» είναι η απάντηση.
«Πρέπει να συμπεριφερόμαστε όλοι σαν να έχουμε κορωνοϊό για να προσέχουμε. Στην Πάτρα υπάρχουν πάρα πολλά παιδιά που είναι θετικά αυτή τη στιγμή. Αν αυτά δεν κολλήσουν τους μεγαλύτερους, όλα θα πάνε καλά».
In early 2020 the new respiratory syndrome COVID‐19 (caused by the zoonotic SARS‐CoV‐2 virus) spread like a pandemic, starting from Wuhan, China, causing severe economic depression. Despite some advances in drug treatments of medical complications in the later stages of the disease, the pandemic’s death toll is tragic, as no vaccine or specific antiviral treatment is currently available. By using a systems approach, we identify the host‐encoded pathway, which provides ribonucleotides to viral RNA synthesis, as a possible target. We show that methotrexate, an FDA‐approved inhibitor of purine biosynthesis, potently inhibits viral RNA replication, viral protein synthesis, and virus release. The effective antiviral methotrexate concentrations are similar to those used for established human therapies using the same drug. Methotrexate should be most effective in patients at the earliest appearance of symptoms to effectively prevent viral replication, diffusion of the infection, and possibly fatal complications.
Highlights
The COVID‐19 pandemic caused by the SARS‐CoV‐2 virus is a global public health threat causing over 800000 deaths, millions of infected people, and severe economic depression.
No vaccine or specific antiviral treatments are currently available.
By inhibiting the host‐encoded pathway, which provides ribonucleotides to viral RNA synthesis, the FDA‐approved drug methotrexate efficiently blocks SARS‐CoV‐2 replication.
1 INTRODUCTION
Due to the massive diffusion of the COVID‐19 pandemic, the present worldwide health emergency, with over 845,000 deaths and millions of infected people, is severely disrupting social and economic activities. If no efficient treatment or specific vaccine is soon available worldwide, the occurrence of a severe global recession, which would bring significant social and economic turmoil, is feared in the future.
COVID‐19 is an infectious respiratory disease caused by SARS‐CoV‐2, a new zoonotic virus that undergoes mutational variability.1 Inhalation of virus‐containing respiratory droplets and airborne transmission represents the most relevant infective routes.2 The vast majority of infected people are asymptomatic or present mild health problems. Asymptomatic and symptomatic patients may present a comparable viral load, and both may be infective.3 The median incubation period (from infection to symptom onset) is 5.1 days. Over 97% of symptomatic patients develop signs of disease within 11.5 days.4
If the invading SARS‐CoV‐2 virus elicits a strong protective immune response, the patient shows non‐severe symptoms. If the immune system fails to eliminate the virus, the patient develops viral pneumonia symptoms, with dyspnea, which may lead to severe and potentially lethal complications.5–7 This more dangerous stage is characterized by a dysfunctional immune response that leads to a cytokine storm, which predisposes to hemostatic abnormalities.5–7 High levels of interleukin‐6 (IL‐6), together with significant levels of SARS‐CoV‐2 RNA, are an index of a high lethality risk. In the most severe cases, acute respiratory distress syndrome (ARDS), often complicated by pulmonary thromboembolism, occurs finally, leading to death.8, 9 Extension of the viral infection to extrapulmonary districts10 may have a role in the diffused post‐COVID syndrome.11
Patients with mild symptoms receive mostly symptomatic treatments.6 Patients in the severe stage receive anti‐inflammatory drugs, including low doses of steroids or drugs acting on the IL‐6 axis.12 As the COVID‐19 pandemic would be substantially constrained by a drug blocking the reproduction of viral particles, several studies are ongoing12 to reposition available drugs looking for their ability to interfere with essential viral functions.
The novelty of the present report is provided by considering, in a system biology approach, not only the events of viral entrance and reproduction into lung type II pneumocytes but also their necessary collaboration with the human host cellular pathways, among which the one providing nucleotides required for the synthesis of viral RNA. The synthesis of purines (a component of nucleotides) is inhibited by methotrexate (4‐amino‐10‐methyl folic acid, MTX),13 an FDA approved drug, used to treat several cancer types and, at lower doses, autoimmune diseases. Herein, we present the first round of experiments “in vitro,” which clearly show that MTX blocks, with high efficiency, SARS‐CoV‐2 replication in the post‐entry phase.
2 MATERIALS AND METHODS
2.1 Cells
African green monkey kidney Vero E6 cell line was obtained from American Type Culture Collection (ATCC) and maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo‐Fisher Scientific) at 37°C in a humidified atmosphere of 5% CO2.
2.2 Virus
We successfully isolated SARS‐CoV‐2 in Vero E6 cells from the nasopharyngeal swab sample of a COVID‐19 patient. The identity of the strain was verified in Vero E6 cells by real‐time polymerase chain reaction (PCR) and by metagenomic sequencing, from which the reads mapped to nCoV‐2019 (genomic data are available at EBI under study accession n. PRJEB38101). We propagated the clinical isolate in Vero E6 cells and determined the viral titer by a standard plaque assay. We performed infection experiments in a biosafety level‐3 (BLS‐3) laboratory at a multiplicity of infection (MOI) of 0.05 and 1.0.
2.3 Efficacy study of MTX
Vero E6 cells were seeded at a density of 5 × 104 cells/well in a 24‐well plate and treated with different doses of MTX (Sigma‐Aldrich). The efficacy of MTX was determined by CellTiter‐Glo (Promega) that measures the ATP levels and direct counting of the viable cell number after trypan‐blue staining.
2.4 Evaluation of antiviral efficacy of methotrexate
Vero E6 cells were infected for one h with the SARS‐CoV‐2 isolate at an MOI of 0.05. Infection was carried out in DMEM medium without FBS. Then, after virus removal and washing with warm phosphate‐buffered saline (we cultured cells in a medium containing 2% FBS in the presence or the absence of MTX at the concentration of 25, 2.5, or 0.25 μM. At 48 h postinfection, both cells and supernatants were collected for further viral genome quantification analysis.
2.5 Viral RNA extraction and quantitative real‐time reverse‐transcription PCR (qRT‐PCR)
RNA was extracted from clarified cell culture supernatants (16,000g × 10 min) and infected cells using a QIAamp Viral RNA Mini Kit and RNeasy Plus mini kit (Qiagen), respectively, according to the manufacturer’s instructions.
RNA was eluted in 30 μl of RNase‐free water and stored at –80°C till use. The qRT‐PCR was carried‐out following previously described procedures with minor modifications.14 Briefly, reverse transcription and amplification of the S gene were performed using the one‐step QuantiFast Sybr Green RT‐PCR mix (Qiagen) as follows: 50°C for 10 min, 95°C for 5 min; 95°C for 10 s, 60°C for 30 s (40 cycles) (primers: RBD‐qF1: 5’‐CAATGGTTTAACAGGCACAGG‐3’ and RBD‐qR1: 5’‐CTCAAGTGTCTGTGGATCACG‐3). A standard curve was generated by determination of copy numbers derived from serial dilutions (103–109 copies) of a pGEM T‐easy vector (Promega) containing the receptor‐binding domain of the S gene (primers: RBD‐F: 5’‐GCTGGATCCCCTAATATTACAAACTTGTGCC‐3’; RBD‐R: 5’‐TGCCTCGAGCTCAAGTGTCTGTGGATCAC‐3’). Each quantification was run in triplicate.
2.6 Western blot analysis
Protein samples (30 µg) obtained from lysis in RIPA buffer (Cell Signaling Technology, Danvers) of Vero E6 infected cells were separated on 10% sodium dodecyl sulphate‐polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes (Millipore, Sigma). After being blocked with 3% bovine serum albumin in tris buffered saline buffer containing 0.05% Tween 20, the blot was probed with a human serum (1:1000 dilution) containing IgG to the SARS‐CoV‐2 nucleoprotein (NP) and with mouse anti‐human GAPDH monoclonal antibody (G‐9; Santa Cruz Biotechnology). The antigen‐antibody complexes were detected using peroxidase‐conjugated goat anti‐human or goat antimouse IgG (Sigma) and revealed using the enhanced chemiluminescence (ECL) system (Santa Cruz Biotechnology).
2.7 Statistical analysis
Data were analyzed for statistical significance using the one‐way analysis of variance, and the Bonferroni post test was used to compare data. Differences were considered significant when p < .05. Statistical tests were performed using GraphPad Prism 8.
3 RESULTS
3.1 Effects of methotrexate on Vero E6 cells growth and metabolism
At first, we assayed the effect of various concentrations of MTX on cell proliferation of Vero E6 cells, an established model system for SARS‐CoV‐2 isolation and replication. After 48 h of culture, 0.015 µM MTX has a negligible effect on the extent of growth, assayed as the viable cell number detected by the Trypan Blue dye exclusion test. At this very low concentration, MTX inhibition may be competitively displaced by the intracellular substrate of DHFR. MTX concentrations ranging from 0.06 to 2.5 µM have a potent inhibitory effect (around 45%) that becomes substantially stronger (85%) at MTX 25 µM (Figure 1A). MTX‐treated cells display a normal surface‐adherent phenotype (Figure 1B).
Determination of antimetabolic and proliferative efficacy of MTX. (A) Inhibition of cell growth after 48 h of culture in the presence of MTX at different concentrations (25, 2.5, 0.25, 0.125, 0.06, 0.03, and 0.015 μM). (B) 10× bright‐field images of Vero E6 cells after incubation for 48 h at 37°C with the indicated MTX concentrations with an initial cell density of 5 × 104 cells/well. (C) measurement of ATP by CellTiter‐Glo as a luminescent readout of cell viability. Red dots in (A) and (C) refer to cells not treated with MTX
MTX severely inhibits the accumulation of cellular ATP (assayed with CellTiter‐Glo). For an extensive range of MTX concentrations, intracellular ATP levels’ inhibition remains reasonably constant, ranging from 73% inhibition at MTX 0.06 µM to 82% for 25 µM (Figure 1C).
Taken together, these data indicate that at concentrations between 0.06 and 2.5 µM, the proliferative ability of MTX‐treated Vero E6 cells correlates with down‐modulation of their metabolic activity, with negligible effects on cell morphology and minor cytotoxicity.
3.2 MTX potently inhibits SARS‐CoV‐2 replication
We infected Vero E6 cells at either low MOI (MOI = 0.05) or high MOI (MOI = 1.0). Quantification of released RNA after 48 h indicates that viral production is very similar at both MOIs (Figure 2A). Therefore, in the following experiments, we use an MOI of 0.05.
Antiviral activity of MTX. (A) Vero E6 cells were infected with SARS‐CoV‐2 at a multiplicity of infection (MOI) of 0.05 or 1.0 for 1 h at 37°C and then washed and cultured for 48 h. Viral yield was quantitated in the cell supernatant by quantitative real‐time reverse‐transcription PCR (qRT‐PCR). At least three independent replicates were performed. Data are representative of two independent experiments with similar results. In (B)–(E), Vero E6 cells were infected with SARS‐CoV‐2 at an MOI of 0.05 in the absence or in the presence of different doses of MTX. (B) Cells were imaged with an optical microscope to detect typical SARS‐CoV‐2‐induced cytolytic effects. (C) Viral yield was quantitated in the cell supernatant by qRT‐PCR. At least three independent replicates were performed. Data are representative of two independent experiments with similar results. (***p < .001). (D) Quantitation of SARS‐CoV‐2 genomes at the intracellular level by qRT‐PCR. At least three independent replicates were performed. Data are representative of two independent experiments with similar results. (**p < .01; ***p < .001). (E) Nucleoprotein (NP) expression in infected cells was analyzed by Western blot (left panel). Densitometric analysis of Western blot results is shown in the right panel. Bars represent mean % inhibition of NP expression in cells treated with MTX at different concentrations, normalized to control SARS‐CoV‐2‐infected cells
Next, we assessed whether MTX could affect the replication of the SARS‐CoV‐2 virus. Vero E6 cells were infected with a primary SARS‐CoV‐2 strain isolated in Brescia, Italy, and one h later they were cultured in the absence or the presence of MTX at the concentrations of 25, 2.5, or 0.25 µM. MTX efficiently inhibits viral replication (Figure 2B‐E). All MTX doses abolish the SARS‐CoV‐2 cytolytic effects on Vero E6 cells, with only limited cytopathic effects detectable at the lowest micromolar dose of MTX used (Figure 2B). Quantification of viral RNA copy number in the cell culture supernatants confirms the potent inhibitory effect of MTX on viral particles’ production, with a reduction of nearly 70‐fold at 25 µM and about 20‐fold at 0.25 µM, as compared with untreated infected cells (Figure 2C). qRT‐PCR quantification of intracellular SARS‐CoV‐2 RNA in SARS‐CoV‐2‐infected cells shows dose‐dependent inhibition of intracellular SARS‐CoV‐2 genome expression, ranging from 40% to 70% at the tested MTX concentrations (from 0.25 to 25 µM) compared with untreated cells (Figure 2D). Western blot with patient antisera15 recognizing the virus NP confirms MTX’s efficacy on virus replication. MTX induces a significant (approximate 60%) inhibition of NP accumulation (Figure 2E). As there are many copies of NP for each RNA molecule in the virion, the detected constant immunoreactive band, observed at all MTX concentrations, may mainly reflect the viral protein present at the beginning of the treatment, masking the robust dose‐dependent inhibition observed in viral RNA assays experiments.
4 DISCUSSION
Our results indicate that MTX efficiently inhibits viral replication at the post‐entry stages of the SARS‐CoV‐2 infection. Its dose‐dependent antiviral activity is extremely potent. Consistent with data reported for Zika Virus infection16 and the established mechanism of action of MTX,13 these pieces of data indicate that the cellular purine biosynthetic pathway is a reliable target to inhibit SARS‐CoV‐2 replication. Accordingly, MTX should be most effective in patients at the earliest appearance of symptoms to prevent the synthesis of new viral RNA and, therefore, the formation of virus particles able to extend the infection to contiguous lung alveolar epithelium and extrapulmonary sites10 and to spread the infection to other people through virus‐containing droplet emission. As viral RNA has been detected in non‐survivors until the point of death, a correlation between virus persistence and poor disease outcome has been proposed.17
In the first 24 h following different routes of administration of 15 mg MTX to rheumatoid arthritis patients, the drug’s plasma concentration remains between 0.1 and 1 μM,18 that is, within the effective range reported in our study (0.25–2.5 μM). As the metronomic, multiple administration of low MTX doses19 may improve drug absorption, the effective doses reported here are compatible with the therapeutically effective (and well‐tolerated) MTX dosage employed in clinical use. These experiments could provide the basis for designing antiviral treatments that are compatible with patient assistance at home, monitored by family doctors under COVID hospitals’ supervision.
In rheumatoid arthritis and other inflammatory syndromes, the molecular target of MTX is not DHFR.13 MTX decreases the levels of interleukin 6 (IL‐6) and soluble IL‐2 receptor, the reduction in cytokine levels being paralleled by an improvement in clinical indices.20 Therefore, in COVID‐19 patients in a more advanced stage, the treatment with MTX is expected to decrease virion production and down‐regulate the IL‐6 pathway, a strategy currently in use in different clinical trials.12
5 CONCLUSIONS
We show that MTX exerts a dose‐dependent, potent inhibition of SARS‐CoV‐2 replication in model cell lines. As it targets an enzyme essential for viral replication, MTX could be used as a first‐line intervention even against heavily mutated SARS‐CoV‐2 variants or emerging epidemics caused by novel RNA viruses. The potential ability of MTX to down‐regulate the cytokine storm typical of later stages of the disease could contribute to making oral MTX a new and effective antiviral treatment for the COVID‐19 pandemic. MTX may also be useful in patients suffering from the post‐COVID syndrome,11 in which systemic permanence and diffusion of the virus play a role.
CONFLICT OF INTERESTS
The authors declare that there is no conflict of interest.
AUTHOR CONTRIBUTIONS
Lilia Alberghina conceived the idea that led to the systems identification of MTX as a potential anti‐COVID drug; Arnaldo Caruso planned the in vitro experiments. Francesca Caccuri isolated, expanded, and titrated the primary SARS‐CoV‐2 isolate obtained in Brescia, Italy. Francesca Caccuri and Alberto Zani performed experiments on the antiviral activity of MTX by quantitating viral genome expression in cells and in cell culture supernatants. Antonella Bugatti performed experiments on the metabolic activity of MTX‐treated or MTX‐untreated cells and on the SARS‐CoV‐2 NP antigen expression in cells by Western blot; Paolo Bonfanti, Carlo F. Perno, and Marina E. Cazzaniga evaluated clinical perspectives; Arnaldo Caruso and Francesca Caccuri analyzed in vitro data; Arnaldo Caruso, Marco Vanoni, and Lilia Alberghina collected data and wrote the manuscript; Cristina Messa and Carlo F. Perno assembled, coordinated and guided the multidisciplinary team; all the authors discussed, reviewed and approved the manuscript.
The world has bet the farm on vaccines as the solution to the pandemic, but the trials are not focused on answering the questions many might assume they are. Peter Doshi reports
As phase III trials of covid-19 vaccines reach their target enrolments, officials have been trying to project calm. The US coronavirus czar Anthony Fauci and the Food and Drug Administration leadership have offered public assurances that established procedures will be followed.1234 Only a “safe and effective” vaccine will be approved, they say, and nine vaccine manufacturers issued a rare joint statement pledging not to prematurely seek regulatory review.5
But what will it mean exactly when a vaccine is declared “effective”? To the public this seems fairly obvious. “The primary goal of a covid-19 vaccine is to keep people from getting very sick and dying,” a National Public Radio broadcast said bluntly.6
Peter Hotez, dean of the National School of Tropical Medicine at Baylor College of Medicine in Houston, said, “Ideally, you want an antiviral vaccine to do two things . . . first, reduce the likelihood you will get severely ill and go to the hospital, and two, prevent infection and therefore interrupt disease transmission.”7
Yet the current phase III trials are not actually set up to prove either (table 1). None of the trials currently under way are designed to detect a reduction in any serious outcome such as hospital admissions, use of intensive care, or deaths. Nor are the vaccines being studied to determine whether they can interrupt transmission of the virus.
Table 1
Characteristics of ongoing phase III covid-19 vaccine trials
In a September interview Medscape editor in chief Eric Topol pondered what counts as a recorded “event” in the vaccine trials. “We’re not talking about just a PCR [polymerase chain reaction test]-positive mild infection. It has to be moderate to severe illness to qualify as an event, correct?” he asked.8
“That’s right,” concurred his guest, Paul Offit, a vaccinologist who sits on the FDA advisory committee that may ultimately recommend the vaccines for licence or emergency use authorisation.
But that’s not right. In all the ongoing phase III trials for which details have been released, laboratory confirmed infections even with only mild symptoms qualify as meeting the primary endpoint definition.9101112 In Pfizer and Moderna’s trials, for example, people with only a cough and positive laboratory test would bring those trials one event closer to their completion. (If AstraZeneca’s ongoing UK trial is designed similarly to its “paused” US trial for which the company has released details, a cough and fever with positive PCR test would suffice.)
Part of the reason may be numbers. Severe illness requiring hospital admission, which happens in only a small fraction of symptomatic covid-19 cases, would be unlikely to occur in significant numbers in trials. Data published by the US Centers for Disease Control and Prevention in late April reported a symptomatic case hospitalisation ratio of 3.4% overall, varying from 1.7% in 0-49 year olds and 4.5% in 50-64 year olds to 7.4% in those 65 and over.13 Because most people with symptomatic covid-19 experience only mild symptoms,14 even trials involving 30 000 or more patients would turn up relatively few cases of severe disease.
In the trials, final efficacy analyses are planned after just 150 to 160 “events,”—that is, a positive indication of symptomatic covid-19, regardless of severity of the illness.
Yet until vaccine manufacturers began to release their study protocols in mid-September, trial registries and other publicly released information did little to dispel the notion that it was severe covid-19 that the trials were assessing. Moderna, for example, called hospital admissions a “key secondary endpoint” in statements to the media.15 And a press release from the US National Institutes of Health reinforced this impression, stating that Moderna’s trial “aims to study whether the vaccine can prevent severe covid-19” and “seeks to answer if the vaccine can prevent death caused by covid-19.”16
But Tal Zaks, chief medical officer at Moderna, told The BMJ that the company’s trial lacks adequate statistical power to assess those outcomes. “The trial is precluded from judging [hospital admissions], based on what is a reasonable size and duration to serve the public good here,” he said.
Hospital admissions and deaths from covid-19 are simply too uncommon in the population being studied for an effective vaccine to demonstrate statistically significant differences in a trial of 30 000 people. The same is true of its ability to save lives or prevent transmission: the trials are not designed to find out.
Zaks said, “Would I like to know that this prevents mortality? Sure, because I believe it does. I just don’t think it’s feasible within the timeframe [of the trial]—too many would die waiting for the results before we ever knew that.”
Stopping transmission
What about Hotez’s second criterion, interrupting virus transmission, which some experts have argued17 should be the most important test in phase III studies?
“Our trial will not demonstrate prevention of transmission,” Zaks said, “because in order to do that you have to swab people twice a week for very long periods, and that becomes operationally untenable.”
He repeatedly emphasised these “operational realities” of running a vaccine trial. “Every trial design, especially phase III, is always a balancing act between different needs,” he said. “If you wanted to have an answer on an endpoint that happens at a frequency of one 10th or one fifth the frequency of the primary endpoint, you would need a trial that is either 5 or 10 times larger or you’d need a trial that is 5 or 10 times longer to collect those events. Neither of these, I think, are acceptable in the current public need for knowing expeditiously that a vaccine works.”
Zaks added, “A 30 000 [participant] trial is already a fairly large trial. If you’re asking for a 300 000 trial then you need to talk to the people who are paying for it, because now you’re talking about not a $500m to $1bn trial, you’re talking about something 10 times the size. And I think the public purse and operational capabilities and capacities we have are rightly spent not betting the farm on one vaccine but, as Operation Warp Speed [the US government’s covid-19 vaccine plan] is trying to do, making sure that we’re funding several vaccines in parallel.”
Debating endpoints
Still, it’s fair to say that most of the general public assumes that the whole point of the current trials, besides testing safety (box 1), is to see whether the vaccine can prevent bad outcomes. “How do you reconcile that?” The BMJ asked Zaks.
Box 1
Safety and side effects
History shows many examples of serious adverse events from vaccines brought to market in periods of enormous pressure and expectation. There were contaminated polio vaccines in 1955, cases of Guillain-Barré syndrome in recipients of flu vaccines in 1976, and narcolepsy linked to one brand of influenza vaccine in 2009.1819
“Finding severe rare adverse events will require the study of tens of thousands of patients, but this requirement will not be met by early adoption of a product that has not completed its full trial evaluation,” Harvard drug policy researchers Jerry Avorn and Aaron Kesselheim recently wrote in JAMA.20
Covid-19 vaccine trials are currently designed to tabulate final efficacy results once 150 to 160 trial participants develop symptomatic covid-19—and most trials have specified at least one interim analysis allowing for the trials to end with even fewer data accrued.
Medscape’s Eric Topol has been a vocal critic of the trials’ many interim analyses. “These numbers seem totally out of line with what would be considered stopping rules,” he says. “I mean, you’re talking about giving a vaccine with any of these programmes to tens of millions of people. And you’re going to base that on 100 events?”8
Great uncertainty remains over how long a randomised trial of a vaccine will be allowed to proceed. If efficacy is declared, one possibility is that the thousands of volunteers who received a saline placebo would be offered the active vaccine, in effect ending the period of randomised follow-up. Such a move would have far reaching implications for our understanding of vaccines’ benefits and harms, rendering uncertain our knowledge of whether the vaccines can reduce the risk of serious covid-19 disease and precluding any further ability to compare adverse events in the experimental versus the placebo arm.
“It’ll be a decision we’ll have to take at that time. We have not committed one way or another,” Moderna’s Tal Zaks told The BMJ. “It will be a decision where FDA and NIH will also weigh in. And it will be probably a very difficult decision, because you will be weighing the benefit to the public in continuing to understand the longer term safety by keeping people on placebo and the expectation of the people who have received placebo to be crossed over now that it has been proved effective.”
“Very simply,” he replied. “Number one, we have a bad outcome as our endpoint. It’s covid-19 disease.” Moderna, like Pfizer and Janssen, has designed its study to detect a relative risk reduction of at least 30% in participants developing laboratory confirmed covid-19, consistent with FDA and international guidance.2122
Number two, Zaks pointed to influenza vaccines, saying they protect against severe disease better than mild disease. To Moderna, it’s the same for covid-19: if its vaccine is shown to reduce symptomatic covid-19, it will be confident it also protects against serious outcomes.
But the truth is that the science remains far from clear cut, even for influenza vaccines that have been used for decades. Although randomised trials have shown an effect in reducing the risk of symptomatic influenza, such trials have never been conducted in elderly people living in the community to see whether they save lives.
Only two placebo controlled trials in this population have ever been conducted, and neither was designed to detect any difference in hospital admissions or deaths.23 Moreover, dramatic increases in use of influenza vaccines has not been associated with a decline in mortality (box 2).26
Box 2
Not enrolling enough elderly people or minorities
A vaccine that has been proved to reduce the risk of symptomatic disease by a certain proportion should, you might think, reduce serious outcomes such as hospital admissions and deaths in equal proportion.
Peter Marks, an FDA official with responsibility over vaccine approvals, recently stated as much about influenza vaccination, which “only prevents flu in about half the people who get it. And yet that’s very important because that means that it leads to half as many deaths related to influenza each year.”24
But when vaccines are not equally effective in all populations the theory breaks down.
If frail elderly people, who are understood to die in disproportionate numbers from both influenza25 and covid-19, are not enrolled into vaccine trials in sufficient numbers to determine whether case numbers are reduced in this group, there can be little basis for assuming any benefit in terms of hospital admissions or mortality. Whatever reduction in cases is seen in the overall study population (most of which may be among healthy adults), this benefit may not apply to the frail elderly subpopulation, and few lives may be saved.
This is hard to evaluate in the current trials because there are large gaps in the types of people being enrolled in the phase III trials (table 1). Despite recruiting tens of thousands, only two trials are enrolling children less than 18 years old. All exclude immunocompromised people and pregnant or breastfeeding women, and though the trials are enrolling elderly people, few or perhaps none of the studies would seem to be designed to conclusively answer whether there is a benefit in this population, despite their obvious vulnerability to covid-19.
“Adults over 65 will be an important subgroup that we will be looking at,” Moderna’s Zaks told The BMJ. “That said . . . any given study is powered for its primary endpoint—in our case covid-19 disease irrespective of age.”
Al Sommer, dean emeritus of the Johns Hopkins School of Public Health, told The BMJ, “If they have not powered for evidence of benefit in the elderly, I would find that a significant, unfortunate shortcoming.” He emphasised the need for “innovative follow-up studies that will enable us to better determine the direct level of protection immunisation has on the young and, separately, the elderly, in addition to those at the highest risk of severe disease and hospitalisation.”
One view is that trial data should be there for all target populations. “If we don’t have adequate data in the greater than 65 year old group, then the greater than 65 year old person shouldn’t get this vaccine, which would be a shame because they’re the ones who are most likely to die from this infection,” said vaccinologist Paul Offit.8 “We have to generate those data,” he said. “I can’t see how anybody—the Data and Safety Monitoring Board or the FDA Vaccine Advisory Committee, or FDA decision-makers—would ever allow a vaccine to be recommended for that group without having adequate data.”
“I feel the same way about minorities,” Offit added. “You can’t convince minority populations to get this vaccine unless they are represented in these trials. Otherwise, they’re going to feel like they’re guinea pigs, and understandably so.”
Sarah Tanveer helped research the design of studies and identify quotations, and Ulrich Keil provided comments on an early draft of this article.
Footnotes
Competing interests: I co-wrote an op-ed on this topic with Eric Topol, who is quoted in this article, I have been pursuing the public release of vaccine trial protocols, and I co-signed an open letter to the FDA calling for independence and transparency in covid-19 vaccine related decision making.
Provenance and peer review: Commissioned; externally peer reviewed.
This article is made freely available for use in accordance with BMJ’s website terms and conditions for the duration of the covid-19 pandemic or until otherwise determined by BMJ. You may use, download and print the article for any lawful, non-commercial purpose (including text and data mining) provided that all copyright notices and trade marks are retained.
. The efficacy of influenza vaccination in elderly individuals. A randomized double-blind placebo-controlled trial. JAMA1994;272:1661–5. doi:10.1001/jama.1994.03520210045030pmid:7966893
. Efficacy and effectiveness of influenza vaccines: a systematic review and meta-analysis. Lancet Infect Dis2012;12:36–44. doi:10.1016/S1473-3099(11)70295-Xpmid:22032844
. Impact of influenza vaccination on seasonal mortality in the US elderly population. Arch Intern Med2005;165:265–72. doi:10.1001/archinte.165.3.265pmid:15710788
Διάσημος Ιταλός Ψυχίατρος:θα ρίξουν νέο επικίνδυνο ιό για ν’ ανακτήσουν τον έλεγχο της κατάστασης.Καθώς ο covid19 ως επί το πλείστον είναι θεραπεύσιμος!. Το πρόβλημα είναι εξω-ιατρικό είναι γεωπολιτικό, οικονομικό, συνδέεται με 1 σύστημα διακυβέρνησης!Οι άνθρωποι προτιμούν τα πειραματικά εμβόλια από τις θεραπείες:Οι Big Pharma οδηγούν σε ψυχιατρικό σύνδρομο” ΒΙΝΤΕΟ
Ο διακεκριμένος Ιταλός Ψυχίατρος Alessandro Meluzzi: “Δεν μπορώ να μιλήσω ελεύθερα, έχω ήδη λάβει 7 επιστολές από τον Ιατρικό Σύλλογο”
“Δεν θέλω να μιλήσω για την υγειονομική περίθαλψη γιατί έχω ήδη λάβει επτά επιστολές από τον Ιατρικό Σύλλογο”: αυτή είναι η αποκάλυψη που έκανε στα μικρόφωνα των Fabio Duranti και Francesco Vergovich ο καθηγητής Alessandro Meluzzi. Ζωντανά σUn Giorno Speciale στο Radio Radio Tv, ο διάσημος ψυχίατρος είπε ότι είχε λάβει επτά επιστολές υπογεγραμμένες από τον ιατρικό Σύλλογο, που του ζητούν εξηγήσεις σχετικά με τις θέσεις που έλαβε ο Meluzzi δημοσίως…
“Λέω πράγματα που όλος ο κόσμος μπορεί να δει (τα αυτονόητα) – συνέχισε ο εγκληματολόγος – αλλά το ίδιο το γεγονός ότι τα λέω θεωρήθηκε κοινωνικά επικίνδυνο”. Είναι γνωστό ότι η γνώμη του Alessandro Meluzzi συγκρούεται τις περισσότερες φορές με τα δόγματα που ανέκυψαν από την καθεστωτική μοναδική αλήθεια. Και υπό αυτή την έννοια, το ζήτημα της υγείας του covid δεν αποτελεί εξαίρεση.
“Δεν θα χαλαρώσουν με τα εμβόλια”
«Αυτή η ψυχο-υγειονομική δικτατορία είναι λειτουργική για τις οικονομικές κυβερνητικές τάξεις του πλανητικού επιπέδου. Δεν νομίζω ότι θα αρκεστούν, κορεστούν μόνο με το εμβόλιο των 100 δισεκατομμυρίων δολαρίων. Ούτε θα υποχωρήσουν με το τέλος αυτής της φάσης, επειδή η νέα αναδιάρθρωση του χρηματοπιστωτικού καπιταλισμού θα πρέπει να διασφαλίσει οι λαοί και οι μεσαίες τάξεις να είναι εντελώς στερημένες.
Αυτές οι ελίτ που κυβερνούν τον πλανήτη δεν θα χαλαρώσουν με εμβόλια. Αυτό είναι μόνο το ορεκτικό. Είμαι πεπεισμένος ότι οι μισοί άνθρωποι θα εμβολιαστούν, οι άλλοι μισοί δεν θα εμβολιαστούν. Ο ιός θα συνεχίσει να κυκλοφορεί, αλλά δεν θα είναι το μεγάλο πρόβλημα. Αυτό δεν είναι το κύριο πρόβλημα, διότι είναι μια πολύ θεραπεύσιμη ασθένεια στις περισσότερες περιπτώσεις. Έτσι, στο τέλος, το πραγματικό πρόβλημα, αν μη τι άλλο, θα ξαναρχίσει μ’ έναν άλλο πιο επικίνδυνο ιό για να ανακτήσουν τον έλεγχο της κατάστασης. Το ζήτημα είναι εντελώς εξω-ιατρικό, είναι εντελώς εξω-ιατρικό. Είναι γεωπολιτικό, οικονομικό, συνδέεται με ένα σύστημα διακυβέρνησης. Για εμάς τους Ιταλούς δεν υπάρχει ελπίδα: η γραμμή αντίστασης του πολιτισμού, του νόμου, της δημοκρατίας είναι στο ελάχιστο (σσ. όπως και στην Ελλάδα). Όλοι θα λάβουν τα εμβόλια που πρέπει να κάνουν, μετά τα οποία το σύστημα θα συνεχιστεί με άλλους τρόπους. Έχει ήδη αποφασιστεί “.
Alessandro Meluzzi: “Είναι το μοντέλο της έρευνας”
“Δεν θέλω να μιλήσω για την υγειονομική περίθαλψη γιατί έχω ήδη λάβει επτά επιστολές από τον ιατρικό Σύλλογο. Δεν ζούμε πλέον σε ένα καθεστώς στο οποίο ένας απόφοιτος ιατρός ή ένας γιατρός μπορούν να εκφραστούν ελεύθερα. Έχω ήδη λάβει επτά επιστολές που μου ζητούν εξηγήσεις σχετικά με τις θέσεις μου που εκφράζονται δημόσια. Προφανώς κρίθηκαν επικίνδυνες από τον ιατρικό σύλλογο. Αν επιμείνω θα με πετάξουν εκτός Συλλόγου. Λέω πράγματα που όλοι τα βλέπουν, αλλά το ίδιο το γεγονός ότι τα λέμε θεωρείται κοινωνικά επικίνδυνα. Αυτό είναι το μοντέλο της Έρευνας. Δεν θέλω να συγκρουστώ με τις ισχυρές δυνάμεις ».
Οι άνθρωποι προτιμούν τα πειραματικά εμβόλια από τις θεραπείες:Οι Big Pharma οδηγούν σε ψυχιατρικό σύνδρομο
Eίπε ακόμη: ”Τα εμβόλια είναι πειραματικές θεραπείες. Ωστόσο, οι άνθρωποι επιλέγουν πειραματική θεραπεία αντί μιας θεραπείας όταν αρρωσταίνουν. Αυτή είναι μια ψυχιατρική πτυχή.
Οι θεραπείες που μπορούν να νικήσουν το covid συζητούνται ήδη πριν φτάσει το εμβόλιο. Ωστόσο, στο τελευταίο δίνεται ιδιαίτερη προσοχή παρά στις θεραπείες όπως την υδροξυχλωροκίνη 200mg (plaqeunil) έως την ιβερμεκτίνη (Scaball) 3mg, οι οποίες προσφέρουν εξαιρετικά αποτελέσματα για τη θεραπεία της νόσου.
Όχι μόνο η προσοχή των μέσων μαζικής ενημέρωσης, αλλά και η προτίμηση των περισσότερων πολιτών φαίνεται να πέφτει σε ένα προϊόν που αναπτύχθηκε μέσα σε ένα χρόνο και του οποίου η αποτελεσματικότητα είναι ακόμη υπό συζήτηση. Αυτό είναι μια «ψυχιατρική πτυχή […] ένα σύνδρομο που οι φαρμακοβιομηχανίες και η Big Pharma έχουν εύκολα καλλιεργήσει».
Οι άνθρωποι δεν μπορούν να ανεχθούν ότι μπορεί να υπάρχει ένας ιός που μπορεί να μας κάνει να αρρωστήσουμε με μια ασυμπτωματική νόσο στο 85% των περιπτώσεων και paucisymptomatic στο 95%. Και ότι σε ορισμένα γενετικά προδιάθετα άτομα μπορεί να δώσει μια απολύτως αποτρέψιμη ενδοαγγειακή πνευμονική πήξη με κορτιζόνη, ηπαρίνη και μια ασήμαντη αντιφλεγμονώδη.Όπου έγινε αυτή η θεραπεία, κανείς δεν πέθανε, ούτε καν στη δεκαετία του ’90. Αλλά αυτή είναι μια απαράδεκτη έννοια στον πολιτισμό μας.
Οι ιοί αποτελούν θεμελιώδη παράγοντα στην ανθρώπινη εξέλιξη. Η ανθρωπότητα ζούσε πάντα με ιούς. Επομένως, αυτή η ιδέα της αποστείρωσης πάντων με εμβόλια είναι μια παράξενη ιδέα που δεν αντιστοιχεί στην πραγματικότητα της ανοσολογίας ή της ιολογίας.Μπορείτε επίσης να πάρετε όλα τα εμβόλια του κόσμου, αλλά δεν θα σας αφήσουν ποτέ να ελευθερωθείτε!” προειδοποιεί ο Γιατρός και δικαιώνεται τόσο στην Γαλλία όσο και στην Αγγλία κρίθηκε οι εμβολιασμένοι να τηρούν όλα τα μέτρα με τους ανεμβολίαστους..
Αν έχετε μια σωτηριολογική θεώρηση για την επιστημονική τεχνολογία και θεωρείτε ότι αυτή θα σας λύσει το πρόβλημα άμεσα η εμπιστοσύνη στο σώμα σας στο ανοσοποιητικό σας στο ενδοκρινολογικό σας καταρρέει. Αυτό είναι ένα σύνδρομο που εκμεταλλεύθηκαν οι φαρμακευτικές εταιρίες κι οι Big Pharma».
«Αυτός ο ιός, με εμβόλιο ή μη εμβόλιο, προορίζεται να γίνει ενδημικός ιός. Όπως τρισεκατομμύρια άλλοι ιοί. Δεν είναι ότι αυτή η εκστρατεία μαζικού εμβολιασμού θα κάνει τον ιό να εξαφανιστεί. Ας βγάλουμε τον ιό από το μυαλό μας. Ο ιός θα επανεμφανίζεται περιοδικά και θα πρέπει να αντιμετωπιστεί.”Ξεχάστε ότι μετά από αυτήν την πλανητική εκστρατεία εμβολιασμού ο ιός θα τελειώσει, άλλοι θα φτάσουν”.Γνωρίζουμε ότι ακόμη και αν εμβολιαστούν, οι άνθρωποι μπορούν ακόμα να διαδώσουν το covid και να μολύνουν ο ένας τον άλλον. Κανένας, ωστόσο, δεν μπορεί ακόμη να πει εάν οι νέες παραλλαγές που συνεχίζουν να εμφανίζονται είναι περισσότερο ή λιγότερο ευαίσθητες στις ενέσεις. Και πάλι, η παρουσία νέων ιών στο μέλλον δεν αποκλείστηκε από εκείνους που, όπως ο Μπιλ Γκέιτς, είχαν ήδη προβλέψει την κατάσταση έκτακτης ανάγκης που θα έρθει αργότερα με το Sars-Cov-2.”Όλοι θα εμβολιάσουν και μετά θα υπάρξει ένας άλλος ιός: ξεχάστε τον κόσμο από πριν”radioradio/imolaoggi 28/3/21
Παράδειγμα ένας Γάλλος ιατρός που τολμάει και τον καπελώνουν,
O Χειρούργος Dr Eric Loridan: για το σχολείο τα παιδιά θα υποβάλλονται συστηματικά σε τεστ. Τα παιδιά σας είναι όμηροι αφότου φόρεσαν τη διαρκή μάσκα στο σχολείο.Θα δεχθείτε το πέρασμα στα τεστ; Θα το πάτε μέχρι την άκρη μέχρι που θα υπακούσετε στα επίσης βλακώδη εμβόλια; Τα παιδιά σας δεν είναι άρρωστα,δεν μολύνουν, δεν σκοτώνουν.ΒΙΝΤΕΟ
Δραματικές σκηνές στην Ευρώπη από επιστήμονες που αντιστέκονται στη ψύχωση κόβιντ και την κοβιντομηχανική χειραγώγησης. O Χειρούργος Dr Eric Loridanεμφανίζεται ως όμηρος σε βίντεο με λευκοπλάστη στο στόμα φιμωμένος που γράφει ‘‘λογοκρισία”. Για την υγειονομική δικτατορία αναφέρει μεταξύ άλλων: …Μαθαίνω ότι στην επάνοδο των παιδιών στο σχολείο θα γίνονται τεστ με συστηματικό τρόπο. Τα παιδιά σας είναι όμηροι αφότου υποβλήθηκαν στη μάσκα όλη την ώρα στο σχολείο.Θα δεχθείτε το πέρασμά τους στα τεστ. Θα το πάτε μέχρι την άκρη μέχρι που εσείς θα υπακούσετε επίσης στα επίσης βλακώδη εμβόλια; Τα παιδιά σας δεν είναι άρρωστα , τα παιδιά σας δεν μολύνουν, δεν σκοτώνουν παπούδες και γιαγιάδες. Σε ποια γλώσσα πρέπει να το πούμε για ν΄ακούσετε αυτούς που σας προειδοποιούν επί του θέματος εδώ και πολυάριθμους μήνες.Θα σταματήσετε να δείχνετε εμπιστοσύνη σε αυτή την ……. Tα παιδιά είναι σάρκα από τη σάρκα σας είναι το αίμα σας. Είστε έτοιμοι τώρα να προσπαθήσετε να τα υπερασπιστείτε λίγο να σταματήσετε να τα ενοχοποιείτε να σταματήσετε να επιτρέπετε να τα ενοχοποιούν. Θα μου πείτε ναι , αλλά αυτό είναι υποχρεωτικό αν δεν κάνουν έτσι δεν θα πάνε σχολείο αν δεν βάλουν τη μάσκα τους απαγορεύουν το σχολείο. Κι έπειτα αυτό είναι το ίδιο για εμάς πρέπει να βάζουμε την μάσκα στη δουλειά , πρέπει το ένα πρέπει το άλλο καταλαβαίνετε αντίθετα έχουμε πρόστιμο 135 ευρώ (για τη μάσκα) αυτό είναι υποχρεωτικό…όχι δεν είμαι υποχρεωμένος δεν είστε υποχρεωμένοι. Υπακούετε .. Yπακούετε. Σε ένα κοπάδι όταν τα πρόβατα κάνουν τυφλή εμπιστοσύνη στους βοσκούς αυτά υπακούουν αυτό που μένει να αποδειχθεί είναι αν ο βοσκός είναι ένας Καλός ποιμήν ή ένας μισθοφόρος.
Μήνυμα στους Διευθυντές των σχολείων
ΛΟΓΟΚΡΙΘΗΚΕ
Σας εμπιστευόμαστε τα παιδιά μας .. δοκιμάσατε να γνωρίσετε μ΄έναν μικρό μηχανισμό όπως αυτόν που καλείται saturometre-κορεσμόμετρο(μετράει κορεσμό οξυγόνου) ποιές ήταν οι συνέπειες στην οξυγόνωση του αίματός τους κατά τη διάρκεια μας ολόκληρης μέρας με μάσκα. Στοιχίζει 20 ευρώ . Μπορείτε εύκολα να το προμηθευθείτε και να το εγκαταστήσετε για να ξέρετε τι γίνεται. Σας εξηγώ ο κορεσμός σε οξυγόνο οφείλει να είναι πάνω από 95% τότε όλα είναι νορμάλ. Στις μονάδες κάτω από 95% προβλέπεται αναπνευστήρας. Στην πραγματικότητα αυτό το τεστ απαιτεί πολύ προσοχή.
Επιλέξτε το στρατόπεδο σας γιατί μια μέρα θα υπάρχει αυτό (και σηκώνει μια καρτέλα που γράφει) Νυρεμβέργη γι αυτούς που υπερασπίστηκαν την υγειονομική δικτατορία. … Τα παιδιά μας είναι αθώα η μέση ηλικία θανόντων από κόβιντ είναι 84 ετών. Σας λένε δεν υπάρχει θεραπεία ότι η υδροχλωρικίνη και η ιβερμεκτίνη δεν λειτουργούν. Σας το είπαν απλά γιατί αν χρειάζεστε το εμβόλιο για να πάτε στην αγορά σκοτώνοντας όλους τους εμβολιασμένους σε μεγάλη κλίμακα πρέπει να μην υπάρχει θεραπεία. Η πιθανότητα να είστε εμβολιασμένοι για να έχετε πρόσβαση στην αγορά απαιτεί μηδενική θεραπεία (την εξαφάνισή της).Αλλά οι γιατροί που βλέπουν περισσότερους δημοσιογράφους παρά ασθενείς και παίρνουν και το παράσημο της Λεγεώνας της τιμής σας λένε ότι αυτές οι θεραπείες είναι αναποτελεσματικές.Γι όλα αυτά τόλμησαν να σας επιβάλουν απαγόρευση στις 6 το απόγευμα ως τις 6 το πρωί ούτε στη γερμανική κατοχή δεν το ζήσαμε αυτό.
Ναι τα νοσοκομεία είναι γεμάτα και πάντα και ιδιαίτερα το χειμώνα και ξέρετε γιατί σε 20 χρόνια ‘έκλεισαν δεκάδες χιλιάδες νοσοκομειακές κλίνες για λόγους εξοικονόμησής της υγείας καταλαβαίνετε .. αν θέλετε να ξανακεδίσετε την ελευθερία σας κυκλοφορήστε έξω χωρίς μάσκα…
Για τα εμβόλια ζητάει από τον κόσμο να μην γίνουν ινδικά χοιρίδια
O Γιώργος Ευαγγελάτος ψυχίατρος – ψυχαναλυτής παρέχει ψυχιατρική βοήθεια και συμβουλευτική σε ανθρώπους που αντιμετωπίζουν προσωπικές ή οικογενειακές ψυχολογικές και ψυχοκοινωνικές δυσκολίες. Μάθετε περισσότερα για εμάς εδώ.
Πρόσφατα Σχόλια